Incidental Mutation 'R5058:Hyal5'
ID391014
Institutional Source Beutler Lab
Gene Symbol Hyal5
Ensembl Gene ENSMUSG00000029678
Gene Namehyaluronoglucosaminidase 5
Synonyms
MMRRC Submission 042648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5058 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24857997-24891958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24891485 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 433 (F433L)
Ref Sequence ENSEMBL: ENSMUSP00000144011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031689] [ENSMUST00000200968]
Predicted Effect probably damaging
Transcript: ENSMUST00000031689
AA Change: F433L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031689
Gene: ENSMUSG00000029678
AA Change: F433L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104008
Predicted Effect probably damaging
Transcript: ENSMUST00000200968
AA Change: F433L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144011
Gene: ENSMUSG00000029678
AA Change: F433L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201585
Meta Mutation Damage Score 0.0476 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Reproduction is normal in mice with null mutations at this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,242,625 Y222C probably damaging Het
Adprhl2 A G 4: 126,318,445 S94P probably damaging Het
Atp11b A G 3: 35,809,361 E202G probably benign Het
Cacna1d G T 14: 30,114,244 S849* probably null Het
Camsap1 T C 2: 25,939,363 D783G probably benign Het
Cbfa2t2 T A 2: 154,504,745 I124N probably damaging Het
Ccdc13 A T 9: 121,817,547 probably benign Het
Cfap44 G A 16: 44,420,204 probably null Het
Col17a1 C A 19: 47,685,550 E13* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dennd6b A G 15: 89,187,350 L288P possibly damaging Het
Dhx37 A C 5: 125,422,231 Y638D probably benign Het
Epb41 G A 4: 132,007,435 probably benign Het
Esp31 A T 17: 38,644,609 I48L possibly damaging Het
Fat3 T C 9: 15,996,858 Q2616R probably damaging Het
Fbxo33 A G 12: 59,219,133 I116T probably benign Het
Flnb G T 14: 7,924,262 E1792* probably null Het
Fzd2 G A 11: 102,604,807 G26R probably damaging Het
Gm11677 T A 11: 111,725,438 noncoding transcript Het
Gm7137 A T 10: 77,788,071 probably benign Het
Hnrnpr A G 4: 136,336,337 T252A possibly damaging Het
Kcnmb4 T A 10: 116,463,928 probably benign Het
Meltf A G 16: 31,887,603 probably null Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Muc6 T C 7: 141,644,224 D1213G probably benign Het
Ncam1 A C 9: 49,798,695 F12C probably benign Het
Nfxl1 A T 5: 72,556,239 D120E probably benign Het
Nrg1 T C 8: 31,824,559 Q142R probably damaging Het
Olfr132 G A 17: 38,130,541 S217F probably damaging Het
Olfr180 T C 16: 58,916,072 T190A probably benign Het
Olfr250 C A 9: 38,367,924 T116K probably damaging Het
Olfr347 T G 2: 36,734,999 L226R possibly damaging Het
Olfr466 C A 13: 65,152,929 A235D possibly damaging Het
Olfr684 T C 7: 105,157,148 N178S probably damaging Het
Olfr948 C A 9: 39,318,664 V317L probably benign Het
Olfr95 A G 17: 37,211,667 L62P probably damaging Het
Padi2 G T 4: 140,932,121 V246L probably benign Het
Pgghg C T 7: 140,942,542 T63I possibly damaging Het
Pitpnm1 A G 19: 4,112,758 N1117S probably benign Het
Plch1 G T 3: 63,722,781 T534K probably damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Polr3c T C 3: 96,723,517 I196V probably benign Het
Prph A T 15: 99,055,232 probably benign Het
Ptprg C A 14: 12,037,387 T189K possibly damaging Het
R3hcc1 A T 14: 69,704,014 I183N probably damaging Het
Rundc1 T C 11: 101,425,537 L145P probably benign Het
Slc26a3 A G 12: 31,470,965 K723E possibly damaging Het
Slc38a3 T C 9: 107,659,191 E2G possibly damaging Het
Slc9a5 G T 8: 105,355,858 V252L probably benign Het
Smim26 C T 2: 144,595,123 T64M probably benign Het
Socs4 C T 14: 47,290,132 R175* probably null Het
Srebf2 T C 15: 82,182,050 S600P probably damaging Het
Tas2r107 A T 6: 131,659,742 S115T probably damaging Het
Tenm2 T C 11: 36,207,080 D447G possibly damaging Het
Thbs2 T A 17: 14,676,329 D766V probably damaging Het
Tinagl1 A G 4: 130,167,457 V300A probably benign Het
Tle6 T A 10: 81,594,238 N332I possibly damaging Het
Tle6 C A 10: 81,595,957 W151L probably damaging Het
Tnfrsf13c C T 15: 82,224,207 V36M probably damaging Het
Tns2 T C 15: 102,107,860 I211T possibly damaging Het
Trp63 A G 16: 25,882,594 N379D probably damaging Het
Trpc2 T C 7: 102,089,109 W433R probably damaging Het
Tyw1 T A 5: 130,277,086 L350Q probably benign Het
Usf3 T C 16: 44,212,707 L76P probably damaging Het
Vmn2r79 T C 7: 87,002,215 L274P probably damaging Het
Other mutations in Hyal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Hyal5 APN 6 24876481 missense possibly damaging 0.92
IGL01407:Hyal5 APN 6 24876407 missense probably benign 0.08
IGL01799:Hyal5 APN 6 24891337 missense probably benign 0.09
IGL02070:Hyal5 APN 6 24876962 missense probably damaging 1.00
IGL02087:Hyal5 APN 6 24876725 missense probably damaging 1.00
IGL02188:Hyal5 APN 6 24877036 missense probably damaging 1.00
IGL02321:Hyal5 APN 6 24891615 missense probably benign 0.01
IGL02975:Hyal5 APN 6 24891452 missense probably benign 0.41
IGL03299:Hyal5 APN 6 24877882 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0499:Hyal5 UTSW 6 24877921 missense probably damaging 1.00
R1491:Hyal5 UTSW 6 24877903 missense probably benign 0.00
R1575:Hyal5 UTSW 6 24876793 missense probably damaging 1.00
R1967:Hyal5 UTSW 6 24876194 missense possibly damaging 0.68
R2182:Hyal5 UTSW 6 24877880 missense probably damaging 1.00
R3801:Hyal5 UTSW 6 24876524 missense probably benign 0.44
R3877:Hyal5 UTSW 6 24876631 missense probably damaging 1.00
R4642:Hyal5 UTSW 6 24876622 missense probably benign 0.01
R4826:Hyal5 UTSW 6 24891576 missense possibly damaging 0.82
R5161:Hyal5 UTSW 6 24891603 missense probably benign 0.00
R5249:Hyal5 UTSW 6 24876649 nonsense probably null
R5459:Hyal5 UTSW 6 24891251 missense probably damaging 0.98
R5685:Hyal5 UTSW 6 24876692 missense probably benign 0.39
R5741:Hyal5 UTSW 6 24876495 missense probably damaging 1.00
R5849:Hyal5 UTSW 6 24891556 missense probably benign 0.00
R6156:Hyal5 UTSW 6 24891438 missense possibly damaging 0.92
R6351:Hyal5 UTSW 6 24891709 unclassified probably null
R6573:Hyal5 UTSW 6 24891552 missense probably damaging 0.96
R6949:Hyal5 UTSW 6 24876304 missense probably benign 0.00
R6966:Hyal5 UTSW 6 24891292 missense probably damaging 1.00
R7148:Hyal5 UTSW 6 24876902 missense probably damaging 1.00
R7422:Hyal5 UTSW 6 24875984 start gained probably benign
X0061:Hyal5 UTSW 6 24876973 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGTAGCCAAACCCTTTGC -3'
(R):5'- ACATCTTTTCTTGGCACACATG -3'

Sequencing Primer
(F):5'- CCAGAATCAAGGCGTGTGTTC -3'
(R):5'- TTGGCACACATGGACTCACTG -3'
Posted On2016-06-06