Incidental Mutation 'R5023:Tank'
ID391076
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R5023 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 61578635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112502]
Predicted Effect probably benign
Transcript: ENSMUST00000078074
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112502
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145632
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abca8b A G 11: 109,974,988 probably null Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dnah7a C A 1: 53,647,248 E248* probably null Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Lama2 G A 10: 27,190,504 T1127I probably damaging Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufa7 A G 17: 33,824,603 probably benign Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ttk A G 9: 83,863,541 D647G probably damaging Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1671:Tank UTSW 2 61649753 missense probably damaging 0.99
R1862:Tank UTSW 2 61649912 missense probably damaging 1.00
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R5950:Tank UTSW 2 61653569 utr 3 prime probably benign
R6221:Tank UTSW 2 61650083 missense probably damaging 1.00
R6626:Tank UTSW 2 61650296 splice site probably benign
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACGGGTGGTTTCAGAACATTTTC -3'
(R):5'- CTTCTAACCCTGATGCGGATG -3'

Sequencing Primer
(F):5'- AACATTTTCTGGTAGTTTTTGCTTC -3'
(R):5'- CCTGATGCGGATGCCAAAG -3'
Posted On2016-06-06