Incidental Mutation 'R5023:Lama2'
ID391135
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R5023 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27190504 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1127 (T1127I)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000092639
AA Change: T1127I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: T1127I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189575
AA Change: T1127I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: T1127I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abca8b A G 11: 109,974,988 probably null Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dnah7a C A 1: 53,647,248 E248* probably null Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufa7 A G 17: 33,824,603 probably benign Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tank G A 2: 61,578,635 probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ttk A G 9: 83,863,541 D647G probably damaging Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATCTGTATGCCAATGAGCATACATC -3'
(R):5'- TGTAACTGCAGCACTGTGGG -3'

Sequencing Primer
(F):5'- TCAAGAAAACCTGTGTCTGGC -3'
(R):5'- CTTCTCAGTGCAATGTAAACACGGG -3'
Posted On2016-06-06