Incidental Mutation 'R0437:Prdm15'
ID39118
Institutional Source Beutler Lab
Gene Symbol Prdm15
Ensembl Gene ENSMUSG00000014039
Gene NamePR domain containing 15
SynonymsZfp298, E130018M06Rik
MMRRC Submission 038638-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R0437 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97791467-97851850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97812559 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 470 (M470K)
Ref Sequence ENSEMBL: ENSMUSP00000120497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095849] [ENSMUST00000121584] [ENSMUST00000142295]
Predicted Effect probably benign
Transcript: ENSMUST00000095849
AA Change: D546E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093533
Gene: ENSMUSG00000014039
AA Change: D546E

DomainStartEndE-ValueType
SET 75 191 5.96e-1 SMART
ZnF_C2H2 223 245 3.99e0 SMART
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 402 424 3.89e-3 SMART
ZnF_C2H2 434 457 2.75e-3 SMART
ZnF_C2H2 468 488 1.88e2 SMART
ZnF_C2H2 495 517 5.42e-2 SMART
ZnF_C2H2 522 544 1.36e-2 SMART
ZnF_C2H2 571 593 6.23e-2 SMART
ZnF_C2H2 598 620 2.75e-3 SMART
low complexity region 642 657 N/A INTRINSIC
ZnF_C2H2 661 684 2.17e-1 SMART
ZnF_C2H2 689 711 3.24e0 SMART
ZnF_C2H2 725 747 1.38e-3 SMART
ZnF_C2H2 753 775 5.67e-5 SMART
ZnF_C2H2 781 803 3.11e-2 SMART
ZnF_C2H2 809 831 8.34e-3 SMART
ZnF_C2H2 837 859 4.79e-3 SMART
ZnF_C2H2 865 888 4.79e-3 SMART
ZnF_C2H2 894 917 5.06e-2 SMART
low complexity region 948 959 N/A INTRINSIC
low complexity region 1148 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121584
AA Change: D520E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113791
Gene: ENSMUSG00000014039
AA Change: D520E

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
ZnF_C2H2 197 219 3.99e0 SMART
low complexity region 264 277 N/A INTRINSIC
ZnF_C2H2 376 398 3.89e-3 SMART
ZnF_C2H2 408 431 2.75e-3 SMART
ZnF_C2H2 442 462 1.88e2 SMART
ZnF_C2H2 469 491 5.42e-2 SMART
ZnF_C2H2 496 518 1.36e-2 SMART
ZnF_C2H2 545 567 6.23e-2 SMART
ZnF_C2H2 572 594 2.75e-3 SMART
low complexity region 616 631 N/A INTRINSIC
ZnF_C2H2 635 658 2.17e-1 SMART
ZnF_C2H2 663 685 3.24e0 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 5.67e-5 SMART
ZnF_C2H2 755 777 3.11e-2 SMART
ZnF_C2H2 783 805 8.34e-3 SMART
ZnF_C2H2 811 833 4.79e-3 SMART
ZnF_C2H2 839 862 4.79e-3 SMART
ZnF_C2H2 868 891 5.06e-2 SMART
low complexity region 922 933 N/A INTRINSIC
low complexity region 1122 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142295
AA Change: M470K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120497
Gene: ENSMUSG00000014039
AA Change: M470K

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
low complexity region 230 243 N/A INTRINSIC
ZnF_C2H2 342 364 3.89e-3 SMART
ZnF_C2H2 369 392 2.75e-3 SMART
ZnF_C2H2 403 423 1.88e2 SMART
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,953 L21P probably damaging Het
4833420G17Rik G A 13: 119,470,095 R291K probably benign Het
4932438A13Rik A T 3: 36,989,804 H2820L possibly damaging Het
Abca2 T C 2: 25,442,845 S1519P probably damaging Het
Abcb11 G A 2: 69,257,295 A1042V probably damaging Het
Abcc10 A T 17: 46,312,919 probably null Het
Abcc10 G T 17: 46,312,920 probably benign Het
Alkbh3 A C 2: 93,981,569 L240V probably damaging Het
Apol10b T C 15: 77,585,408 S190G probably benign Het
Atp1a3 C A 7: 24,998,967 C135F probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
BC030499 T C 11: 78,291,536 L57P probably benign Het
Bicra A G 7: 15,988,762 S277P possibly damaging Het
Bmp8a T C 4: 123,316,897 E275G probably benign Het
Ccdc102a T C 8: 94,913,426 E80G probably damaging Het
Cdh23 T C 10: 60,410,797 D954G probably damaging Het
Chrm4 A G 2: 91,928,443 T399A possibly damaging Het
Clcn3 A G 8: 60,934,537 V199A possibly damaging Het
Crlf1 T C 8: 70,499,514 probably null Het
Crx G T 7: 15,871,146 S57* probably null Het
Cyp4f16 A G 17: 32,537,098 I34V possibly damaging Het
Daxx T C 17: 33,913,624 V576A probably benign Het
Ddx17 C T 15: 79,537,471 R351H probably damaging Het
Dhx38 T C 8: 109,558,629 probably benign Het
Dnd1 T C 18: 36,764,499 probably benign Het
Dync1i2 A T 2: 71,227,825 probably null Het
E2f6 T C 12: 16,816,445 S52P probably benign Het
Epb41l4a A G 18: 33,880,273 F116S probably damaging Het
Ext1 T C 15: 53,106,106 N362S probably damaging Het
Fam227a C A 15: 79,643,988 K79N possibly damaging Het
Fam228a T A 12: 4,732,759 L111F probably damaging Het
Fat2 T C 11: 55,282,799 T2363A probably benign Het
Fat3 A T 9: 15,996,932 N2591K probably damaging Het
Frem2 A G 3: 53,653,015 M1357T possibly damaging Het
Frmd4b A T 6: 97,423,463 V29D probably damaging Het
G930045G22Rik A G 6: 50,846,938 noncoding transcript Het
Galnt3 A G 2: 66,107,229 S46P possibly damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Herc2 C T 7: 56,219,815 R4271* probably null Het
Il5 C A 11: 53,723,906 probably benign Het
Ints9 G A 14: 64,986,369 probably benign Het
Itga10 T C 3: 96,649,137 F196S probably damaging Het
Itgb3bp T C 4: 99,781,889 T138A probably damaging Het
Kcnd1 G A X: 7,824,683 V281M probably benign Het
Lcp2 T C 11: 34,087,229 L391P probably benign Het
Lrrc66 T C 5: 73,607,687 Y671C probably benign Het
Mettl23 T C 11: 116,849,294 V197A possibly damaging Het
Mmp15 C A 8: 95,370,772 D456E probably benign Het
Mospd4 T C 18: 46,465,781 noncoding transcript Het
Mov10l1 C A 15: 89,005,312 H484N probably damaging Het
Mphosph9 T C 5: 124,315,568 Q197R probably benign Het
Ms4a1 T A 19: 11,256,569 probably null Het
Mybbp1a T C 11: 72,448,848 V919A possibly damaging Het
Mycbpap A T 11: 94,513,512 probably benign Het
Naip6 G A 13: 100,296,924 S1135F possibly damaging Het
Ndufc2 T A 7: 97,400,337 M50K probably benign Het
Npr2 T C 4: 43,648,082 V842A probably damaging Het
Ntsr2 G T 12: 16,653,695 G66W probably damaging Het
Obscn T C 11: 58,995,088 probably benign Het
Olfr1206 T A 2: 88,864,885 N93K probably benign Het
Olfr1219 T A 2: 89,074,612 I160F probably benign Het
Olfr427 G A 1: 174,100,399 G314R probably benign Het
Olfr820 T C 10: 130,018,096 V245A probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Otud4 T A 8: 79,669,997 H628Q probably benign Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pex16 G T 2: 92,375,592 R10L probably damaging Het
Pitpnm2 A G 5: 124,131,089 probably benign Het
Pom121l2 A G 13: 21,983,205 T549A possibly damaging Het
Prkag2 T A 5: 25,028,505 D49V possibly damaging Het
Prl3c1 A G 13: 27,199,464 M38V probably benign Het
Prpf18 T A 2: 4,643,761 I85F possibly damaging Het
Psg27 A G 7: 18,560,711 probably benign Het
Relt A G 7: 100,848,784 probably benign Het
Serpina3b A T 12: 104,130,670 N70I probably damaging Het
Slc19a3 T C 1: 83,022,565 S244G probably benign Het
Slc39a5 T C 10: 128,399,847 T81A possibly damaging Het
Slc7a2 G A 8: 40,904,526 G277D probably damaging Het
Slc9c1 C T 16: 45,599,887 probably benign Het
Slx1b A G 7: 126,692,581 F104L probably benign Het
Smg6 G A 11: 74,929,701 S266N probably damaging Het
Spata9 T C 13: 75,998,495 V162A possibly damaging Het
Szrd1 T C 4: 141,118,744 I47V probably benign Het
Tha1 G T 11: 117,868,575 L363M probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Tmem132d C T 5: 127,789,785 G684R probably damaging Het
Trim55 G A 3: 19,670,978 G220S probably benign Het
Ttn A G 2: 76,770,530 L18836P probably damaging Het
Ubn1 G T 16: 5,072,184 probably benign Het
Ush2a T G 1: 188,911,031 W4197G probably benign Het
Vmn1r189 A T 13: 22,102,061 V202E probably damaging Het
Vmn1r209 T C 13: 22,806,356 I55V probably benign Het
Vmn2r86 A T 10: 130,446,543 C735S probably damaging Het
Vwf A T 6: 125,566,318 D174V probably damaging Het
Zfp438 T C 18: 5,214,910 N16S probably damaging Het
Zfp444 C T 7: 6,189,409 T142I probably benign Het
Zfp804a A G 2: 82,053,791 M1V probably null Het
Zfp936 T G 7: 43,189,310 I67S probably benign Het
Zfp948 A T 17: 21,586,998 N151Y unknown Het
Other mutations in Prdm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Prdm15 APN 16 97806167 splice site probably benign
IGL01325:Prdm15 APN 16 97806517 missense probably damaging 1.00
IGL02195:Prdm15 APN 16 97835829 missense probably damaging 1.00
IGL02473:Prdm15 APN 16 97837605 unclassified probably null
IGL02502:Prdm15 APN 16 97839339 missense probably damaging 1.00
IGL02604:Prdm15 APN 16 97821942 missense probably benign
R0408:Prdm15 UTSW 16 97835786 missense possibly damaging 0.92
R0497:Prdm15 UTSW 16 97794334 missense possibly damaging 0.63
R0590:Prdm15 UTSW 16 97797761 missense possibly damaging 0.95
R0630:Prdm15 UTSW 16 97837707 missense probably null 1.00
R0661:Prdm15 UTSW 16 97829682 missense probably benign 0.34
R0718:Prdm15 UTSW 16 97812633 missense possibly damaging 0.89
R1144:Prdm15 UTSW 16 97808708 missense probably damaging 1.00
R1240:Prdm15 UTSW 16 97837600 missense probably damaging 0.98
R1605:Prdm15 UTSW 16 97839306 missense probably damaging 1.00
R1908:Prdm15 UTSW 16 97837685 missense probably benign 0.27
R2081:Prdm15 UTSW 16 97803780 nonsense probably null
R2208:Prdm15 UTSW 16 97799264 intron probably null
R3787:Prdm15 UTSW 16 97797745 missense probably benign 0.00
R3890:Prdm15 UTSW 16 97799571 missense probably damaging 1.00
R4326:Prdm15 UTSW 16 97806515 missense probably damaging 1.00
R4728:Prdm15 UTSW 16 97821786 missense probably benign 0.04
R4952:Prdm15 UTSW 16 97806077 missense probably damaging 0.99
R4998:Prdm15 UTSW 16 97794489 missense probably damaging 0.97
R5225:Prdm15 UTSW 16 97808675 missense probably damaging 1.00
R5505:Prdm15 UTSW 16 97816983 missense possibly damaging 0.76
R5628:Prdm15 UTSW 16 97799623 missense probably damaging 0.98
R5721:Prdm15 UTSW 16 97807096 missense possibly damaging 0.74
R5873:Prdm15 UTSW 16 97808689 missense probably damaging 1.00
R5980:Prdm15 UTSW 16 97812570 nonsense probably null
R6311:Prdm15 UTSW 16 97799055 missense probably null 0.08
R6540:Prdm15 UTSW 16 97835805 missense probably benign 0.13
R7053:Prdm15 UTSW 16 97794542 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGTATGCAGGACACCATAATGACC -3'
(R):5'- TTGTGCCGTTCACCCTGTTGAG -3'

Sequencing Primer
(F):5'- GGACACCATAATGACCTTTCTTACAG -3'
(R):5'- TGGTCAGGGGTAATTTACCACAC -3'
Posted On2013-05-23