Incidental Mutation 'R5024:Il6'
ID391215
Institutional Source Beutler Lab
Gene Symbol Il6
Ensembl Gene ENSMUSG00000025746
Gene Nameinterleukin 6
SynonymsIl-6
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5024 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30013114-30019981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30019514 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 184 (L184P)
Ref Sequence ENSEMBL: ENSMUSP00000143157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026845] [ENSMUST00000195978] [ENSMUST00000199183] [ENSMUST00000199765]
Predicted Effect probably damaging
Transcript: ENSMUST00000026845
AA Change: L201P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026845
Gene: ENSMUSG00000025746
AA Change: L201P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 209 2.1e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195978
SMART Domains Protein: ENSMUSP00000143544
Gene: ENSMUSG00000025746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 162 5.8e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199183
SMART Domains Protein: ENSMUSP00000143293
Gene: ENSMUSG00000025746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 175 3.9e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199765
AA Change: L184P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143157
Gene: ENSMUSG00000025746
AA Change: L184P

DomainStartEndE-ValueType
IL6 38 192 2.1e-98 SMART
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show impaired immune response to pathogens, decreased T cell numbers and resistance to plasma cell neoplasia. They are defective in wound healing and liver regeneration and show increased emotionality and high bone turnover rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Il6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Il6 APN 5 30014841 missense probably benign 0.06
IGL01085:Il6 APN 5 30013489 missense probably damaging 0.98
IGL01549:Il6 APN 5 30019471 missense probably benign 0.01
R1510:Il6 UTSW 5 30018062 missense probably damaging 0.96
R1721:Il6 UTSW 5 30013492 missense possibly damaging 0.90
R1774:Il6 UTSW 5 30019435 missense probably benign
R2018:Il6 UTSW 5 30014947 critical splice donor site probably null
R2153:Il6 UTSW 5 30013504 nonsense probably null
R2344:Il6 UTSW 5 30014856 missense probably benign 0.00
R3889:Il6 UTSW 5 30018068 missense possibly damaging 0.57
R4743:Il6 UTSW 5 30018044 missense probably damaging 0.96
R4769:Il6 UTSW 5 30018078 nonsense probably null
R4965:Il6 UTSW 5 30013493 missense possibly damaging 0.53
R5817:Il6 UTSW 5 30018008 missense probably benign
R5858:Il6 UTSW 5 30013474 missense possibly damaging 0.67
R6886:Il6 UTSW 5 30018203 intron probably benign
R7254:Il6 UTSW 5 30014908 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATTAGAACTTCTTCCCACAGCC -3'
(R):5'- TCCAAGAAACCATCTGGCTAG -3'

Sequencing Primer
(F):5'- TTCTTCCCACAGCCCAGAAC -3'
(R):5'- AACCATCTGGCTAGGTAACAG -3'
Posted On2016-06-06