Incidental Mutation 'R5024:Hirip3'
ID391232
Institutional Source Beutler Lab
Gene Symbol Hirip3
Ensembl Gene ENSMUSG00000042606
Gene NameHIRA interacting protein 3
Synonyms
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5024 (G1)
Quality Score214
Status Validated
Chromosome7
Chromosomal Location126861972-126865377 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 126864489 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037248] [ENSMUST00000050833] [ENSMUST00000071268] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000129812] [ENSMUST00000132808] [ENSMUST00000205349] [ENSMUST00000206349] [ENSMUST00000206968] [ENSMUST00000214525]
Predicted Effect probably null
Transcript: ENSMUST00000037248
SMART Domains Protein: ENSMUSP00000035535
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 96 113 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 229 244 N/A INTRINSIC
low complexity region 286 339 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 405 419 N/A INTRINSIC
internal_repeat_1 420 443 6.44e-5 PROSPERO
internal_repeat_1 440 463 6.44e-5 PROSPERO
CHZ 529 565 1.17e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071268
SMART Domains Protein: ENSMUSP00000071246
Gene: ENSMUSG00000059981

DomainStartEndE-ValueType
S_TKc 28 281 6.42e-86 SMART
low complexity region 319 333 N/A INTRINSIC
coiled coil region 373 401 N/A INTRINSIC
low complexity region 449 465 N/A INTRINSIC
coiled coil region 493 526 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
coiled coil region 579 608 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
coiled coil region 821 859 N/A INTRINSIC
low complexity region 863 892 N/A INTRINSIC
low complexity region 931 954 N/A INTRINSIC
low complexity region 963 972 N/A INTRINSIC
low complexity region 977 992 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129746
Predicted Effect probably benign
Transcript: ENSMUST00000129812
SMART Domains Protein: ENSMUSP00000114606
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
SCOP:d1iw7c_ 15 37 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132552
Predicted Effect probably benign
Transcript: ENSMUST00000132808
SMART Domains Protein: ENSMUSP00000115145
Gene: ENSMUSG00000042606

DomainStartEndE-ValueType
low complexity region 36 53 N/A INTRINSIC
low complexity region 88 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably benign
Transcript: ENSMUST00000205349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205512
Predicted Effect probably benign
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect probably benign
Transcript: ENSMUST00000206349
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Predicted Effect probably benign
Transcript: ENSMUST00000214525
Meta Mutation Damage Score 0.6296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The HIRA protein shares sequence similarity with Hir1p and Hir2p, the two corepressors of histone gene transcription characterized in the yeast, Saccharomyces cerevisiae. The structural features of the HIRA protein suggest that it may function as part of a multiprotein complex. Several cDNAs encoding HIRA-interacting proteins, or HIRIPs, have been identified. In vitro, the protein encoded by this gene binds HIRA, as well as H2B and H3 core histones, indicating that a complex containing HIRA-HIRIP3 could function in some aspects of chromatin and histone metabolism. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Hirip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Hirip3 APN 7 126862704 missense probably damaging 1.00
IGL01531:Hirip3 APN 7 126863376 missense possibly damaging 0.72
IGL01885:Hirip3 APN 7 126864209 missense probably benign 0.00
R0126:Hirip3 UTSW 7 126863442 missense probably damaging 0.99
R0270:Hirip3 UTSW 7 126863191 missense probably damaging 0.99
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1185:Hirip3 UTSW 7 126863660 frame shift probably null
R1676:Hirip3 UTSW 7 126863475 unclassified probably null
R1792:Hirip3 UTSW 7 126862620 missense probably damaging 0.98
R1951:Hirip3 UTSW 7 126862866 missense probably damaging 0.96
R2327:Hirip3 UTSW 7 126862866 missense probably damaging 0.96
R4674:Hirip3 UTSW 7 126864662 critical splice donor site probably null
R5523:Hirip3 UTSW 7 126863862 missense possibly damaging 0.62
R6876:Hirip3 UTSW 7 126864149 missense probably damaging 1.00
R7181:Hirip3 UTSW 7 126864063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCAGGAAAAGGGACTTC -3'
(R):5'- TCCTTCCCTGAAGCAGAAATTG -3'

Sequencing Primer
(F):5'- AGCTGCAAACTCCTTATTAGGCTG -3'
(R):5'- CCCTGAAGCAGAAATTGTTTACCTG -3'
Posted On2016-06-06