Incidental Mutation 'R5024:Fbxw25'
ID391242
Institutional Source Beutler Lab
Gene Symbol Fbxw25
Ensembl Gene ENSMUSG00000094992
Gene NameF-box and WD-40 domain protein 25
SynonymsE330001B16Rik
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5024 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109645122-109664652 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 109663374 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163839]
Predicted Effect probably null
Transcript: ENSMUST00000163839
SMART Domains Protein: ENSMUSP00000128652
Gene: ENSMUSG00000094992

DomainStartEndE-ValueType
FBOX 5 45 5.44e-6 SMART
SCOP:d1gxra_ 119 228 1e-6 SMART
Blast:WD40 137 176 6e-6 BLAST
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Fbxw25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03330:Fbxw25 APN 9 109645239 missense probably benign 0.00
R0158:Fbxw25 UTSW 9 109654652 missense possibly damaging 0.74
R0850:Fbxw25 UTSW 9 109649617 missense probably benign
R1109:Fbxw25 UTSW 9 109650060 missense probably benign 0.00
R1386:Fbxw25 UTSW 9 109654641 missense possibly damaging 0.77
R1609:Fbxw25 UTSW 9 109663510 missense probably benign 0.11
R1750:Fbxw25 UTSW 9 109650073 missense probably benign 0.23
R1977:Fbxw25 UTSW 9 109652856 missense possibly damaging 0.72
R2427:Fbxw25 UTSW 9 109652860 missense probably benign 0.09
R3841:Fbxw25 UTSW 9 109662134 nonsense probably null
R4356:Fbxw25 UTSW 9 109662085 missense probably damaging 1.00
R4934:Fbxw25 UTSW 9 109651637 missense possibly damaging 0.63
R5175:Fbxw25 UTSW 9 109664563 missense probably damaging 1.00
R5323:Fbxw25 UTSW 9 109663505 missense probably benign 0.04
R5389:Fbxw25 UTSW 9 109652886 missense possibly damaging 0.95
R5493:Fbxw25 UTSW 9 109652916 missense probably benign 0.01
R6268:Fbxw25 UTSW 9 109654650 missense probably damaging 1.00
R6739:Fbxw25 UTSW 9 109651631 missense probably benign 0.29
R7275:Fbxw25 UTSW 9 109654592 missense
X0023:Fbxw25 UTSW 9 109651775 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAATGTTGAGCAACCACTCAG -3'
(R):5'- AACCATGGCTCTAAGGTGAGG -3'

Sequencing Primer
(F):5'- GCAGATCACAGATTGACTCCATGG -3'
(R):5'- CAACTGTGCATTGCAGGAAATTGTG -3'
Posted On2016-06-06