Incidental Mutation 'R5024:Etv1'
ID391254
Institutional Source Beutler Lab
Gene Symbol Etv1
Ensembl Gene ENSMUSG00000004151
Gene Nameets variant 1
SynonymsEtsrp81, ER81
MMRRC Submission 042615-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R5024 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location38779380-38870484 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 38854234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000161980] [ENSMUST00000162563]
Predicted Effect probably null
Transcript: ENSMUST00000095767
SMART Domains Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5e-153 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159334
SMART Domains Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 16 293 1.1e-112 PFAM
ETS 294 379 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160244
SMART Domains Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 310 2.5e-133 PFAM
ETS 311 396 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160701
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160856
SMART Domains Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 315 3.8e-130 PFAM
ETS 316 401 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161591
Predicted Effect probably null
Transcript: ENSMUST00000161980
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162563
SMART Domains Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5.6e-150 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162730
Meta Mutation Damage Score 0.6364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
Lyst T C 13: 13,634,404 S220P probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Etv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Etv1 APN 12 38781792 splice site probably benign
IGL01376:Etv1 APN 12 38857040 missense probably damaging 1.00
IGL01387:Etv1 APN 12 38861327 missense probably damaging 0.99
IGL01936:Etv1 APN 12 38835061 splice site probably benign
IGL02388:Etv1 APN 12 38781799 missense possibly damaging 0.62
IGL02933:Etv1 APN 12 38781833 missense probably benign 0.22
R0844:Etv1 UTSW 12 38861354 missense probably damaging 1.00
R0993:Etv1 UTSW 12 38827864 missense probably damaging 1.00
R1187:Etv1 UTSW 12 38865564 missense probably damaging 1.00
R1710:Etv1 UTSW 12 38852262 missense probably benign 0.18
R2094:Etv1 UTSW 12 38835116 missense probably null 1.00
R2879:Etv1 UTSW 12 38783810 splice site probably null
R3607:Etv1 UTSW 12 38831086 missense probably damaging 1.00
R4353:Etv1 UTSW 12 38857106 missense probably damaging 1.00
R4646:Etv1 UTSW 12 38865686 missense possibly damaging 0.94
R4678:Etv1 UTSW 12 38835220 missense probably damaging 1.00
R4768:Etv1 UTSW 12 38827793 missense probably damaging 1.00
R4812:Etv1 UTSW 12 38861288 missense probably damaging 1.00
R4877:Etv1 UTSW 12 38831293 unclassified probably null
R5253:Etv1 UTSW 12 38852249 missense possibly damaging 0.50
R5936:Etv1 UTSW 12 38835210 missense probably damaging 1.00
R6085:Etv1 UTSW 12 38854195 missense probably damaging 1.00
R6167:Etv1 UTSW 12 38865641 missense possibly damaging 0.88
R6709:Etv1 UTSW 12 38783797 missense possibly damaging 0.93
R7046:Etv1 UTSW 12 38784370 intron probably null
R7243:Etv1 UTSW 12 38857046 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TACCCACTTGATAGATGGAGGC -3'
(R):5'- AAAGATGCCCTGCTCAGCAC -3'

Sequencing Primer
(F):5'- CGGAGTCCGTTTCAAGACATTG -3'
(R):5'- AACAATGCTGATCTTCTCTCCCG -3'
Posted On2016-06-06