Incidental Mutation 'R5024:Lyst'
ID391256
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Namelysosomal trafficking regulator
SynonymsD13Sfk13
MMRRC Submission 042615-MU
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5024 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13590397-13778803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13634404 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
Predicted Effect probably benign
Transcript: ENSMUST00000110559
AA Change: S220P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: S220P

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223053
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,171,895 N575S probably damaging Het
Akap6 C T 12: 53,142,562 T2253M probably benign Het
Arhgef37 A C 18: 61,506,440 N289K probably damaging Het
Armc4 T C 18: 7,088,555 M1005V probably benign Het
Atad2b A C 12: 4,937,534 T121P probably benign Het
Atp4a A C 7: 30,715,864 D303A possibly damaging Het
BC005561 A G 5: 104,522,258 K1549E possibly damaging Het
Calu A T 6: 29,374,519 probably benign Het
Ccdc141 A C 2: 77,054,703 N531K probably benign Het
Ccdc146 T C 5: 21,399,614 probably null Het
Cd207 G A 6: 83,674,319 T218I probably damaging Het
Cd2ap A C 17: 42,805,345 probably null Het
Clip3 G A 7: 30,292,219 probably benign Het
Clstn1 G A 4: 149,635,294 R432H possibly damaging Het
Csmd2 A G 4: 128,321,348 Y521C possibly damaging Het
Dnah8 A T 17: 30,736,096 E2033V probably damaging Het
Eng T G 2: 32,673,392 V319G probably benign Het
Erp44 C T 4: 48,241,296 W57* probably null Het
Etv1 T A 12: 38,854,234 probably null Het
Eva1c T C 16: 90,876,193 probably null Het
Fam196a A G 7: 134,918,478 S108P probably damaging Het
Fam221b T A 4: 43,659,674 N482I probably damaging Het
Fam83h T C 15: 76,005,142 H202R probably damaging Het
Fbxw13 T C 9: 109,179,335 T449A probably benign Het
Fbxw25 A T 9: 109,663,374 probably null Het
Frmd3 T A 4: 74,098,144 S99T probably benign Het
Gm5155 A G 7: 17,910,682 I575V probably benign Het
Gm5174 G T 10: 86,656,587 noncoding transcript Het
Gm6904 T C 14: 59,258,483 probably null Het
Gm815 C T 19: 26,887,775 Q49* probably null Het
H2-DMa A T 17: 34,138,487 I245F possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hirip3 A G 7: 126,864,489 probably null Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hmcn1 T A 1: 150,680,688 E2449V possibly damaging Het
Igll1 G T 16: 16,863,793 H33N probably benign Het
Il6 T C 5: 30,019,514 L184P probably damaging Het
Impg2 T A 16: 56,260,100 S756T probably damaging Het
Kank4 T G 4: 98,785,661 D5A probably damaging Het
Kcna7 G A 7: 45,406,591 R77H probably damaging Het
Kcns2 A T 15: 34,839,537 T349S probably benign Het
Keap1 A G 9: 21,237,226 Y162H probably damaging Het
Kif9 T C 9: 110,483,093 F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,448,985 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lpar6 A G 14: 73,239,369 T257A probably damaging Het
Lpin1 A T 12: 16,554,006 L608Q probably benign Het
M1ap A G 6: 83,028,358 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Myo5b A T 18: 74,716,034 T1115S possibly damaging Het
Mysm1 C A 4: 94,951,016 V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 noncoding transcript Het
Olfr1040 G T 2: 86,146,533 A67E probably damaging Het
Olfr1062 C T 2: 86,423,461 G72S possibly damaging Het
Olfr292 A T 7: 86,694,881 M142L probably benign Het
Olfr318 T A 11: 58,720,950 I33F probably benign Het
Otud6b T A 4: 14,826,293 Q34L probably damaging Het
Parp11 C T 6: 127,471,636 T72I probably damaging Het
Pbx1 T A 1: 168,183,589 D343V possibly damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pramef20 C A 4: 144,373,308 E296* probably null Het
Ranbp9 A T 13: 43,434,855 I67N probably damaging Het
Rasgrp4 A G 7: 29,148,407 E414G probably damaging Het
Rbbp5 A G 1: 132,490,488 H15R possibly damaging Het
Scd2 A G 19: 44,301,271 Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 G170S probably damaging Het
Sh3bp4 G T 1: 89,145,595 G722C probably damaging Het
Shmt1 A T 11: 60,797,479 probably benign Het
Slc12a1 A G 2: 125,166,137 I206V probably benign Het
Slc26a3 A G 12: 31,453,908 D304G probably benign Het
Slc26a7 T A 4: 14,532,572 D434V possibly damaging Het
Slc6a16 G T 7: 45,259,966 M185I probably benign Het
Stat4 A G 1: 52,082,570 I363V possibly damaging Het
Tgfb1i1 G T 7: 128,248,217 M1I probably null Het
Tmem225 T C 9: 40,149,343 V66A probably benign Het
Tmtc4 T C 14: 122,941,302 probably null Het
Trpc4 T A 3: 54,194,796 N38K probably benign Het
Ttll12 A T 15: 83,587,113 Y218N probably damaging Het
Ttn A T 2: 76,948,425 probably null Het
Tulp1 A C 17: 28,351,995 Y178* probably null Het
Vmn2r58 A G 7: 41,864,322 V299A probably damaging Het
Washc4 C A 10: 83,583,336 Q911K possibly damaging Het
Wdr3 T C 3: 100,154,936 D221G probably benign Het
Zan A T 5: 137,461,893 C1245* probably null Het
Zfyve9 A C 4: 108,691,669 S773A probably benign Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGCGACAGCGTAAAAGTACC -3'
(R):5'- CTACACTGAGTGCTAGGGAAG -3'

Sequencing Primer
(F):5'- CCCATCGTTATTCTGTAAGAGATGC -3'
(R):5'- TGAGTGCTAGGGAAGAATTATGATTC -3'
Posted On2016-06-06