Incidental Mutation 'R5025:Dennd4c'
ID391289
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 86795299 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably null
Transcript: ENSMUST00000045512
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000082026
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142837
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R5970:Dennd4c UTSW 4 86825512 missense probably damaging 1.00
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTTCAGTGGCAGTGC -3'
(R):5'- ATTACCCTGTAGTGACCACAAG -3'

Sequencing Primer
(F):5'- GGCAGTGCCCATATATCCC -3'
(R):5'- TAGGCTGGCTCCAAAGTTAC -3'
Posted On2016-06-06