Incidental Mutation 'R5025:Fbxl18'
ID391294
Institutional Source Beutler Lab
Gene Symbol Fbxl18
Ensembl Gene ENSMUSG00000066640
Gene NameF-box and leucine-rich repeat protein 18
Synonyms
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142866946-142895421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142886313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 389 (I389N)
Ref Sequence ENSEMBL: ENSMUSP00000106394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035985] [ENSMUST00000110766]
Predicted Effect probably damaging
Transcript: ENSMUST00000035985
AA Change: I325N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041700
Gene: ENSMUSG00000066640
AA Change: I325N

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
FBOX 20 61 1.69e-2 SMART
SCOP:d1yrga_ 307 610 2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110766
AA Change: I389N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106394
Gene: ENSMUSG00000066640
AA Change: I389N

DomainStartEndE-ValueType
low complexity region 58 78 N/A INTRINSIC
FBOX 84 125 1.1e-4 SMART
SCOP:d1yrga_ 371 674 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156725
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins that contain an approximately 40-amino acid F-box motif. This motif is important for interaction with SKP1 and for targeting some proteins for degradation. The encoded protein has been shown to control the cellular level of FBXL7, a protein that induces mitotic arrest, by targeting it for polyubiquitylation and proteasomal degradation. Members of the F-box protein family, such as FBXL18, are characterized by an approximately 40-amino acid F-box motif. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Fbxl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Fbxl18 APN 5 142885825 missense probably damaging 0.99
R1384:Fbxl18 UTSW 5 142886223 missense probably damaging 0.96
R1725:Fbxl18 UTSW 5 142886703 missense probably damaging 1.00
R1873:Fbxl18 UTSW 5 142886223 missense probably damaging 0.96
R1874:Fbxl18 UTSW 5 142886223 missense probably damaging 0.96
R1875:Fbxl18 UTSW 5 142886223 missense probably damaging 0.96
R2011:Fbxl18 UTSW 5 142872459 missense probably benign 0.00
R2186:Fbxl18 UTSW 5 142878761 missense probably damaging 1.00
R4977:Fbxl18 UTSW 5 142886085 missense probably damaging 1.00
R5011:Fbxl18 UTSW 5 142886680 missense probably damaging 1.00
R5567:Fbxl18 UTSW 5 142895267 unclassified probably benign
R5570:Fbxl18 UTSW 5 142895267 unclassified probably benign
R5654:Fbxl18 UTSW 5 142885803 missense probably damaging 1.00
R5677:Fbxl18 UTSW 5 142878720 nonsense probably null
R6010:Fbxl18 UTSW 5 142872398 missense probably damaging 1.00
R6302:Fbxl18 UTSW 5 142888823 missense probably damaging 1.00
X0023:Fbxl18 UTSW 5 142886371 missense probably benign 0.00
X0060:Fbxl18 UTSW 5 142885571 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTCTTGCCAAATCCACGGGG -3'
(R):5'- AACTTGCTGGACTCCATGGC -3'

Sequencing Primer
(F):5'- TGCCAAATCCACGGGGTACTG -3'
(R):5'- GACTCCATGGCCCGCAAC -3'
Posted On2016-06-06