Incidental Mutation 'R0441:Tpp2'
ID39131
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R0441 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43990562 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 68 (N68D)
Ref Sequence ENSEMBL: ENSMUSP00000140313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388] [ENSMUST00000190207]
Predicted Effect probably benign
Transcript: ENSMUST00000087933
AA Change: N1015D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: N1015D

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188302
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188313
AA Change: N1002D

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: N1002D

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189388
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190207
AA Change: N68D

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140313
Gene: ENSMUSG00000041763
AA Change: N68D

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
PDB:3LXU|X 87 281 3e-19 PDB
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
eddie UTSW 1 43968988 missense probably damaging 1.00
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGCAGGCACAATCCATGTTAC -3'
(R):5'- GCTCAGTGGGAACTCACAATGCTC -3'

Sequencing Primer
(F):5'- CAATCCATGTTACAAAACTCTTAGC -3'
(R):5'- gtccacagaagccagaagag -3'
Posted On2013-05-23