Incidental Mutation 'R0441:Srgap2'
ID39133
Institutional Source Beutler Lab
Gene Symbol Srgap2
Ensembl Gene ENSMUSG00000026425
Gene NameSLIT-ROBO Rho GTPase activating protein 2
SynonymsFBP2, Fnbp2, 9930124L22Rik
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0441 (G1)
Quality Score169
Status Validated
Chromosome1
Chromosomal Location131285251-131527352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131336437 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 465 (T465I)
Ref Sequence ENSEMBL: ENSMUSP00000095195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000185596] [ENSMUST00000186543]
Predicted Effect probably damaging
Transcript: ENSMUST00000097588
AA Change: T465I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425
AA Change: T465I

DomainStartEndE-ValueType
FCH 22 120 7.33e-18 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 9.6e-60 SMART
SH3 731 786 4.52e-15 SMART
low complexity region 852 868 N/A INTRINSIC
coiled coil region 940 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185596
AA Change: T324I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141140
Gene: ENSMUSG00000026425
AA Change: T324I

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
coiled coil region 222 260 N/A INTRINSIC
Blast:RhoGAP 304 349 5e-12 BLAST
RhoGAP 361 535 5.9e-62 SMART
SH3 590 645 2.8e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186543
AA Change: T465I

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425
AA Change: T465I

DomainStartEndE-ValueType
FCH 22 120 3.7e-20 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 5.9e-62 SMART
SH3 731 786 2.8e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188437
Predicted Effect possibly damaging
Transcript: ENSMUST00000188770
AA Change: T79I

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194760
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Srgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Srgap2 APN 1 131356700 missense possibly damaging 0.89
IGL01738:Srgap2 APN 1 131296426 missense probably benign 0.00
IGL01933:Srgap2 APN 1 131411855 missense probably damaging 1.00
IGL01964:Srgap2 APN 1 131289578 missense probably benign 0.08
IGL02028:Srgap2 APN 1 131296435 missense probably damaging 0.98
IGL02159:Srgap2 APN 1 131319666 splice site probably benign
IGL02326:Srgap2 APN 1 131356907 critical splice acceptor site probably null
IGL02396:Srgap2 APN 1 131292675 missense probably damaging 0.99
IGL02407:Srgap2 APN 1 131319602 missense probably damaging 1.00
IGL02444:Srgap2 APN 1 131325153 splice site probably null
IGL02559:Srgap2 APN 1 131524936 critical splice donor site probably null
IGL02900:Srgap2 APN 1 131411796 splice site probably benign
IGL03150:Srgap2 APN 1 131310600 missense probably damaging 1.00
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0044:Srgap2 UTSW 1 131319551 missense possibly damaging 0.68
R0580:Srgap2 UTSW 1 131349501 missense possibly damaging 0.81
R0882:Srgap2 UTSW 1 131289515 missense probably benign 0.00
R1412:Srgap2 UTSW 1 131300413 missense possibly damaging 0.81
R1501:Srgap2 UTSW 1 131292699 missense probably damaging 1.00
R1740:Srgap2 UTSW 1 131289388 missense probably benign 0.00
R1764:Srgap2 UTSW 1 131319537 missense possibly damaging 0.94
R1772:Srgap2 UTSW 1 131319638 missense probably damaging 0.99
R1776:Srgap2 UTSW 1 131411850 missense probably damaging 1.00
R2393:Srgap2 UTSW 1 131332134 missense probably benign 0.00
R3011:Srgap2 UTSW 1 131310591 missense probably damaging 0.99
R3149:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3150:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3800:Srgap2 UTSW 1 131310559 missense probably damaging 1.00
R4871:Srgap2 UTSW 1 131289472 missense probably benign 0.00
R4884:Srgap2 UTSW 1 131292576 unclassified probably null
R5454:Srgap2 UTSW 1 131289737 missense probably benign 0.08
R5536:Srgap2 UTSW 1 131300390 splice site probably null
R6113:Srgap2 UTSW 1 131355505 splice site probably null
R6174:Srgap2 UTSW 1 131289616 missense probably benign 0.00
R6180:Srgap2 UTSW 1 131349541 missense probably benign 0.00
R6341:Srgap2 UTSW 1 131291629 missense probably benign 0.02
R6357:Srgap2 UTSW 1 131355542 missense probably damaging 1.00
R6363:Srgap2 UTSW 1 131298468 missense probably damaging 1.00
R6770:Srgap2 UTSW 1 131298510 missense probably benign 0.00
R6934:Srgap2 UTSW 1 131317231 missense possibly damaging 0.81
R7007:Srgap2 UTSW 1 131319537 missense probably benign 0.15
R7077:Srgap2 UTSW 1 131344449 missense
R7147:Srgap2 UTSW 1 131310594 missense
R7326:Srgap2 UTSW 1 131291613 nonsense probably null
R7467:Srgap2 UTSW 1 131292667 missense probably damaging 0.97
R7500:Srgap2 UTSW 1 131436831 missense probably damaging 1.00
X0022:Srgap2 UTSW 1 131411949 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTCAAGCAGCCACTGAATAGTC -3'
(R):5'- CAACACTGATGCTCAGGAAGGTCG -3'

Sequencing Primer
(F):5'- CAGCCACTGAATAGTCTAGGAAG -3'
(R):5'- gggagggagggggagag -3'
Posted On2013-05-23