Incidental Mutation 'R5026:Dmxl2'
ID391362
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene NameDmx-like 2
SynonymsE130119P06Rik, 6430411K14Rik
MMRRC Submission 042617-MU
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5026 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54365158-54501626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54416676 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1141 (S1141R)
Ref Sequence ENSEMBL: ENSMUSP00000113705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
Predicted Effect probably damaging
Transcript: ENSMUST00000118163
AA Change: S1141R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: S1141R

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118600
AA Change: S1141R

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: S1141R

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123709
AA Change: S342R
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: S342R

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127880
AA Change: S967R

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: S967R

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
Brsk1 A T 7: 4,704,266 R273W probably damaging Het
C2cd3 T A 7: 100,459,842 M2259K possibly damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cd4 T C 6: 124,866,620 T443A possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Map1a T G 2: 121,307,538 S2660A possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Sez6 T A 11: 77,968,989 F378Y probably damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tial1 C T 7: 128,448,396 E82K probably damaging Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54401523 missense probably benign
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54446512 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54450924 missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54446405 unclassified probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 unclassified probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54450879 missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAAAGTCTCCCATACATG -3'
(R):5'- CATCGTGGGAAGACCTGTTG -3'

Sequencing Primer
(F):5'- TCTCCCATACATGAAGATATTAGCAC -3'
(R):5'- GCTGTTAGCTGCTCATACACAGG -3'
Posted On2016-06-06