Incidental Mutation 'R0441:Agbl2'
ID39139
Institutional Source Beutler Lab
Gene Symbol Agbl2
Ensembl Gene ENSMUSG00000040812
Gene NameATP/GTP binding protein-like 2
SynonymsA430081C19Rik
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0441 (G1)
Quality Score222
Status Validated
Chromosome2
Chromosomal Location90782727-90834437 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 90797483 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 211 (R211*)
Ref Sequence ENSEMBL: ENSMUSP00000129216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect probably null
Transcript: ENSMUST00000037206
AA Change: R211*
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812
AA Change: R211*

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000037219
AA Change: R211*
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812
AA Change: R211*

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051831
AA Change: R211*
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812
AA Change: R211*

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111481
AA Change: R211*
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812
AA Change: R211*

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136058
AA Change: R211*
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812
AA Change: R211*

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149361
Predicted Effect probably null
Transcript: ENSMUST00000170320
AA Change: R211*
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812
AA Change: R211*

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Agbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Agbl2 APN 2 90801045 missense probably damaging 1.00
IGL00515:Agbl2 APN 2 90793960 missense possibly damaging 0.93
IGL01694:Agbl2 APN 2 90801074 missense probably damaging 1.00
IGL02064:Agbl2 APN 2 90784024 utr 5 prime probably benign
IGL02708:Agbl2 APN 2 90801342 missense probably benign 0.23
IGL02715:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02717:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02982:Agbl2 APN 2 90805815 missense probably damaging 1.00
IGL03039:Agbl2 APN 2 90801222 missense possibly damaging 0.93
IGL03339:Agbl2 APN 2 90797563 missense probably damaging 1.00
R0243:Agbl2 UTSW 2 90791481 missense possibly damaging 0.80
R0381:Agbl2 UTSW 2 90784098 missense probably damaging 1.00
R0549:Agbl2 UTSW 2 90789843 splice site probably benign
R0665:Agbl2 UTSW 2 90801210 missense probably damaging 1.00
R1412:Agbl2 UTSW 2 90788954 missense probably benign
R1682:Agbl2 UTSW 2 90784090 missense probably benign 0.06
R1694:Agbl2 UTSW 2 90801320 missense probably damaging 1.00
R1733:Agbl2 UTSW 2 90810745 missense probably damaging 1.00
R1750:Agbl2 UTSW 2 90816376 utr 3 prime probably benign
R1916:Agbl2 UTSW 2 90815441 missense possibly damaging 0.73
R1940:Agbl2 UTSW 2 90811282 missense probably damaging 0.99
R3115:Agbl2 UTSW 2 90805901 missense possibly damaging 0.85
R3407:Agbl2 UTSW 2 90791618 missense probably damaging 1.00
R3710:Agbl2 UTSW 2 90805808 missense probably benign 0.00
R4227:Agbl2 UTSW 2 90801453 missense probably damaging 0.96
R4719:Agbl2 UTSW 2 90815389 missense probably benign 0.01
R4903:Agbl2 UTSW 2 90797473 missense possibly damaging 0.50
R5170:Agbl2 UTSW 2 90803197 missense probably benign 0.10
R5535:Agbl2 UTSW 2 90810006 missense probably benign 0.26
R5677:Agbl2 UTSW 2 90807978 missense possibly damaging 0.66
R6041:Agbl2 UTSW 2 90808027 missense probably benign 0.00
R6195:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6233:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6607:Agbl2 UTSW 2 90801326 missense probably damaging 0.99
R6752:Agbl2 UTSW 2 90803074 missense probably damaging 1.00
R7104:Agbl2 UTSW 2 90797547 missense probably damaging 1.00
R7261:Agbl2 UTSW 2 90788944 missense possibly damaging 0.94
R7555:Agbl2 UTSW 2 90791555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCTGTGCCAAGAATCTGATG -3'
(R):5'- GCCAGCCCTTAATAAGTTCTCTACCAC -3'

Sequencing Primer
(F):5'- CTACTTACAGACTTCAGAGTGGTGC -3'
(R):5'- TTGCAGACATTTCTGATTCCTGG -3'
Posted On2013-05-23