Incidental Mutation 'R5027:Shank2'
ID391428
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 042618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5027 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 144259105 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 663 (Y663*)
Ref Sequence ENSEMBL: ENSMUSP00000149134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000213146]
Predicted Effect probably null
Transcript: ENSMUST00000105900
AA Change: Y227*
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: Y227*

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105902
AA Change: Y606*
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: Y606*

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213146
AA Change: Y663*
Meta Mutation Damage Score 0.668 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apoe C T 7: 19,697,015 A101T probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Asap2 A G 12: 21,204,081 M198V probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
B3gnt5 T A 16: 19,769,694 V221D probably damaging Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Myo7b T A 18: 31,975,212 I1199F probably benign Het
Naca A C 10: 128,048,121 E2140D possibly damaging Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Sharpin T C 15: 76,350,025 probably benign Het
Slitrk1 G A 14: 108,912,308 P324S probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTTGCCCCTCTGTGAACAG -3'
(R):5'- CCTGTATGGTATGGTTGCCAC -3'

Sequencing Primer
(F):5'- ACATTTTGCAGACTTGGGCC -3'
(R):5'- TATGGTATGGTTGCCACAATCCCAG -3'
Posted On2016-06-06