Incidental Mutation 'R5027:Naca'
ID391449
Institutional Source Beutler Lab
Gene Symbol Naca
Ensembl Gene ENSMUSG00000061315
Gene Namenascent polypeptide-associated complex alpha polypeptide
SynonymsLOC380777, skNAC
MMRRC Submission 042618-MU
Accession Numbers

Genbank: NM_013608; MGI: 106095 ; Ensembl: ENSMUST00000092048

Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R5027 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128035575-128048637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 128048121 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 2140 (E2140D)
Ref Sequence ENSEMBL: ENSMUSP00000089680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073868] [ENSMUST00000092048]
Predicted Effect probably benign
Transcript: ENSMUST00000073868
AA Change: E168D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000073532
Gene: ENSMUSG00000061315
AA Change: E168D

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAC 73 130 3.9e-27 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092048
AA Change: E2140D

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089680
Gene: ENSMUSG00000061315
AA Change: E2140D

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
low complexity region 704 718 N/A INTRINSIC
low complexity region 937 954 N/A INTRINSIC
low complexity region 976 998 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1349 1370 N/A INTRINSIC
low complexity region 1489 1504 N/A INTRINSIC
low complexity region 1572 1593 N/A INTRINSIC
low complexity region 1636 1670 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1806 1827 N/A INTRINSIC
low complexity region 1889 1926 N/A INTRINSIC
low complexity region 1943 1957 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
low complexity region 2016 2029 N/A INTRINSIC
Pfam:NAC 2045 2101 1.7e-25 PFAM
low complexity region 2129 2150 N/A INTRINSIC
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a point mutation exhibit decreased bone volume and bone formation associated with accelerated mineralization and immature woven-bone formation. Mice null for the muscle specific isoform die during organogenesis with cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(156) : Targeted, other(1) Gene trapped(155)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apoe C T 7: 19,697,015 A101T probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Asap2 A G 12: 21,204,081 M198V probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
B3gnt5 T A 16: 19,769,694 V221D probably damaging Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Myo7b T A 18: 31,975,212 I1199F probably benign Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Shank2 C A 7: 144,259,105 Y663* probably null Het
Sharpin T C 15: 76,350,025 probably benign Het
Slitrk1 G A 14: 108,912,308 P324S probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Naca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Naca APN 10 128041682 intron probably benign
IGL00990:Naca APN 10 128043800 intron probably benign
IGL01093:Naca APN 10 128048113 missense probably damaging 0.99
IGL01356:Naca APN 10 128041715 intron probably benign
IGL01548:Naca APN 10 128040904 intron probably benign
IGL02089:Naca APN 10 128036489 splice site probably benign
IGL02148:Naca APN 10 128043884 intron probably benign
IGL02494:Naca APN 10 128041310 intron probably benign
IGL02672:Naca APN 10 128040283 intron probably benign
IGL02822:Naca APN 10 128039345 intron probably benign
IGL02904:Naca APN 10 128043290 intron probably benign
IGL02931:Naca APN 10 128047682 missense probably damaging 1.00
IGL02971:Naca APN 10 128041568 intron probably benign
IGL03104:Naca APN 10 128040364 intron probably benign
Sinewy UTSW 10 128048358 missense probably damaging 1.00
D4216:Naca UTSW 10 128044240 missense possibly damaging 0.73
P0042:Naca UTSW 10 128041553 intron probably benign
R0110:Naca UTSW 10 128044790 missense probably benign 0.13
R0220:Naca UTSW 10 128043386 intron probably benign
R0469:Naca UTSW 10 128044790 missense probably benign 0.13
R0528:Naca UTSW 10 128043293 missense probably benign 0.23
R0594:Naca UTSW 10 128040355 intron probably benign
R0626:Naca UTSW 10 128041162 intron probably benign
R0885:Naca UTSW 10 128040179 nonsense probably null
R1129:Naca UTSW 10 128040202 intron probably benign
R1437:Naca UTSW 10 128042179 intron probably benign
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1509:Naca UTSW 10 128043397 intron probably benign
R1561:Naca UTSW 10 128040398 intron probably benign
R1574:Naca UTSW 10 128040398 intron probably benign
R1678:Naca UTSW 10 128043526 intron probably benign
R1901:Naca UTSW 10 128043721 intron probably benign
R2884:Naca UTSW 10 128041678 intron probably benign
R2886:Naca UTSW 10 128041678 intron probably benign
R3176:Naca UTSW 10 128040661 intron probably benign
R3276:Naca UTSW 10 128040661 intron probably benign
R4227:Naca UTSW 10 128041661 intron probably benign
R4388:Naca UTSW 10 128044792 missense probably damaging 0.99
R4402:Naca UTSW 10 128043472 intron probably benign
R4798:Naca UTSW 10 128047803 missense probably null 0.99
R4955:Naca UTSW 10 128042215 intron probably benign
R4996:Naca UTSW 10 128042429 intron probably benign
R5580:Naca UTSW 10 128040593 intron probably benign
R5752:Naca UTSW 10 128041928 intron probably benign
R5788:Naca UTSW 10 128040142 intron probably benign
R6156:Naca UTSW 10 128039291 intron probably benign
R6227:Naca UTSW 10 128043916 intron probably benign
R6317:Naca UTSW 10 128044124 missense probably benign 0.33
R6665:Naca UTSW 10 128048358 missense probably damaging 1.00
X0053:Naca UTSW 10 128048255 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGAGGTTAAGCCCCAATTG -3'
(R):5'- TGCGACATGACCAGTTCTATG -3'

Sequencing Primer
(F):5'- GAGGTTAAGCCCCAATTGTGATACC -3'
(R):5'- GACATGACCAGTTCTATGTCCTTAAC -3'
Posted On2016-06-06