Incidental Mutation 'R5027:Slitrk1'
ID391468
Institutional Source Beutler Lab
Gene Symbol Slitrk1
Ensembl Gene ENSMUSG00000075478
Gene NameSLIT and NTRK-like family, member 1
Synonyms3200001I04Rik
MMRRC Submission 042618-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5027 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location108908800-108914158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108912308 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 324 (P324S)
Ref Sequence ENSEMBL: ENSMUSP00000097897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100322]
Predicted Effect probably benign
Transcript: ENSMUST00000100322
AA Change: P324S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097897
Gene: ENSMUSG00000075478
AA Change: P324S

DomainStartEndE-ValueType
LRR 81 104 1.37e2 SMART
LRR 105 128 1.37e1 SMART
LRR 129 152 4.57e0 SMART
LRR_TYP 153 176 2.75e-3 SMART
LRR 180 200 1.92e2 SMART
LRRCT 212 262 3.45e-5 SMART
LRRNT 340 376 4.28e0 SMART
LRR 374 397 1.86e1 SMART
LRR 398 421 1.49e1 SMART
LRR 422 445 2.68e1 SMART
LRR 446 469 4.98e-1 SMART
LRR_TYP 470 493 6.52e-5 SMART
LRR 494 517 3.46e2 SMART
LRRCT 529 579 3.91e-4 SMART
transmembrane domain 621 643 N/A INTRINSIC
Meta Mutation Damage Score 0.1544 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. However, the protein encoded by this gene lacks the region of homology to neurotrophin receptors. This protein is thought to be involved in neurite outgrowth. Mutations in this gene may be associated with Tourette syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display hypoactivity, reduced male body weight, elevated anxiety- and depression-like behavior, increased norepinephrine content in brain, and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apoe C T 7: 19,697,015 A101T probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Asap2 A G 12: 21,204,081 M198V probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
B3gnt5 T A 16: 19,769,694 V221D probably damaging Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Myo7b T A 18: 31,975,212 I1199F probably benign Het
Naca A C 10: 128,048,121 E2140D possibly damaging Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Shank2 C A 7: 144,259,105 Y663* probably null Het
Sharpin T C 15: 76,350,025 probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Slitrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Slitrk1 APN 14 108911837 missense probably damaging 1.00
IGL00949:Slitrk1 APN 14 108911809 missense probably damaging 0.98
IGL01556:Slitrk1 APN 14 108913018 missense probably damaging 1.00
IGL01924:Slitrk1 APN 14 108911239 missense probably benign 0.08
IGL02389:Slitrk1 APN 14 108912322 missense probably benign
IGL02619:Slitrk1 APN 14 108911917 missense probably benign 0.09
IGL02828:Slitrk1 APN 14 108911616 missense possibly damaging 0.63
R0070:Slitrk1 UTSW 14 108913317 start gained probably benign
R0135:Slitrk1 UTSW 14 108911629 missense probably benign 0.00
R0627:Slitrk1 UTSW 14 108912239 missense probably damaging 1.00
R1529:Slitrk1 UTSW 14 108913277 start codon destroyed probably benign 0.33
R1661:Slitrk1 UTSW 14 108911927 missense probably damaging 1.00
R1711:Slitrk1 UTSW 14 108913096 missense probably benign 0.21
R1960:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R1961:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R4247:Slitrk1 UTSW 14 108912562 missense possibly damaging 0.95
R4394:Slitrk1 UTSW 14 108911303 missense probably benign 0.01
R5241:Slitrk1 UTSW 14 108913012 missense probably benign 0.27
R5599:Slitrk1 UTSW 14 108911812 missense probably benign 0.00
R5835:Slitrk1 UTSW 14 108911572 missense possibly damaging 0.94
R6224:Slitrk1 UTSW 14 108912022 missense probably damaging 1.00
R6489:Slitrk1 UTSW 14 108911303 missense possibly damaging 0.63
R6504:Slitrk1 UTSW 14 108911697 missense probably benign 0.14
R7102:Slitrk1 UTSW 14 108912629 missense probably benign 0.01
R7346:Slitrk1 UTSW 14 108913159 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTGCCCAGATCCAACAGAATG -3'
(R):5'- AGTGGATTCTAGTCTCCCGG -3'

Sequencing Primer
(F):5'- CCAGATCCAACAGAATGAGGTTCTTG -3'
(R):5'- GATTCTAGTCTCCCGGCTCCC -3'
Posted On2016-06-06