Incidental Mutation 'R5027:B3gnt5'
ID391476
Institutional Source Beutler Lab
Gene Symbol B3gnt5
Ensembl Gene ENSMUSG00000022686
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Synonyms
MMRRC Submission 042618-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R5027 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19760208-19772753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19769694 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 221 (V221D)
Ref Sequence ENSEMBL: ENSMUSP00000126157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]
Predicted Effect probably damaging
Transcript: ENSMUST00000079780
AA Change: V221D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: V221D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119468
AA Change: V221D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: V221D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121344
AA Change: V221D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: V221D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152845
Predicted Effect probably damaging
Transcript: ENSMUST00000164397
AA Change: V221D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: V221D

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Meta Mutation Damage Score 0.412 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A G 11: 76,000,221 K54E probably damaging Het
Abca14 T G 7: 120,312,282 I1363R probably benign Het
Abcc1 T C 16: 14,404,053 probably null Het
Adgrf1 T A 17: 43,303,747 F241I probably damaging Het
Afg3l1 T C 8: 123,489,814 M264T probably benign Het
Ankle1 T C 8: 71,408,979 S434P probably damaging Het
Apoe C T 7: 19,697,015 A101T probably damaging Het
Apol11a G T 15: 77,516,953 K213N probably damaging Het
Asap2 A G 12: 21,204,081 M198V probably damaging Het
Atg4b C T 1: 93,786,575 A360V probably benign Het
Baz2b A T 2: 60,098,644 probably benign Het
Cep350 C A 1: 155,933,354 W492L probably benign Het
Cln6 A G 9: 62,847,093 Y139C probably damaging Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cul9 C T 17: 46,500,782 E2507K probably damaging Het
Ddx58 T A 4: 40,208,845 M756L probably benign Het
Dgkz A T 2: 91,945,543 V125D probably benign Het
Dnah17 T C 11: 118,102,539 M1127V probably benign Het
Dnajb1 C A 8: 83,610,103 D67E probably benign Het
Dync1li1 A G 9: 114,713,544 D258G probably damaging Het
Egflam G T 15: 7,253,644 P311T probably benign Het
Fbxw11 T A 11: 32,652,811 probably benign Het
Fn3krp T G 11: 121,429,448 D206E probably benign Het
Fsip2 A G 2: 82,989,133 H5070R possibly damaging Het
Gm6169 A G 13: 97,099,140 I33T probably benign Het
Gm6605 T C 7: 38,450,259 noncoding transcript Het
Gna14 C A 19: 16,603,272 T158K probably benign Het
Gstt2 A T 10: 75,831,892 I243N probably damaging Het
Haus6 C T 4: 86,605,696 D50N possibly damaging Het
Hcrtr2 A G 9: 76,323,296 I70T probably benign Het
Herc1 G A 9: 66,473,529 V3563I probably benign Het
Herc1 A T 9: 66,504,618 I4707F probably damaging Het
Hic2 C T 16: 17,258,747 A480V possibly damaging Het
Hsd17b3 A G 13: 64,062,906 Y212H probably damaging Het
Hspa5 A G 2: 34,775,815 K557R probably damaging Het
Iqch T C 9: 63,525,012 E367G possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lars2 A G 9: 123,441,495 M551V probably benign Het
Lbp T C 2: 158,308,726 I57T possibly damaging Het
Litaf T C 16: 10,961,004 Q142R possibly damaging Het
Lpar5 G C 6: 125,082,147 R277P possibly damaging Het
Muc6 T A 7: 141,636,436 I2710F probably benign Het
Myo7b T A 18: 31,975,212 I1199F probably benign Het
Naca A C 10: 128,048,121 E2140D possibly damaging Het
Nup214 G T 2: 31,991,317 G396C probably damaging Het
Olfr1052 G A 2: 86,298,196 V127I possibly damaging Het
Olfr259 T A 2: 87,107,806 I194F probably benign Het
Olfr56 A T 11: 49,134,624 Q144L probably benign Het
Olfr853 A G 9: 19,537,277 Y218H probably damaging Het
Olfr983 A T 9: 40,092,394 S187T probably damaging Het
P4htm A G 9: 108,579,293 V436A probably benign Het
Pfkm A G 15: 98,119,426 I117V possibly damaging Het
Phlpp1 T G 1: 106,281,471 V518G probably damaging Het
Piwil4 G A 9: 14,709,944 L598F probably damaging Het
Polr1b T G 2: 129,123,883 I815R possibly damaging Het
Ppef2 T C 5: 92,234,291 N515S probably damaging Het
Prpsap2 G T 11: 61,741,004 probably null Het
Rab27a A G 9: 73,095,413 D208G probably benign Het
Ralgds A G 2: 28,552,090 probably null Het
Raph1 C A 1: 60,496,277 C540F probably damaging Het
Rbsn A G 6: 92,198,250 L281P probably damaging Het
Rmdn1 G T 4: 19,588,533 G110* probably null Het
Rph3a T A 5: 120,954,449 E363V possibly damaging Het
Serpina16 G T 12: 103,675,003 Y154* probably null Het
Sh2d3c G A 2: 32,744,802 E198K possibly damaging Het
Shank2 C A 7: 144,259,105 Y663* probably null Het
Sharpin T C 15: 76,350,025 probably benign Het
Slitrk1 G A 14: 108,912,308 P324S probably benign Het
Sorbs2 T A 8: 45,746,534 probably null Het
Spag16 C T 1: 69,923,804 probably benign Het
Sycp2l A T 13: 41,129,771 probably null Het
Synj1 A T 16: 90,940,519 probably null Het
Sytl1 T C 4: 133,256,219 probably benign Het
Tkfc A T 19: 10,592,659 probably null Het
Tnn T C 1: 160,145,211 T274A probably damaging Het
Trav14-2 T A 14: 53,641,048 W35R probably damaging Het
Trim72 T C 7: 128,007,965 M222T probably damaging Het
Trim9 A G 12: 70,346,708 V154A probably damaging Het
Ttc7b T C 12: 100,301,742 Y266C probably damaging Het
Uchl3 T A 14: 101,666,546 I43K possibly damaging Het
Vdac1 T A 11: 52,388,478 N269K possibly damaging Het
Wdr72 T A 9: 74,145,976 W187R probably damaging Het
Zfp30 T A 7: 29,793,066 C248* probably null Het
Zfp940 A T 7: 29,850,956 probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in B3gnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:B3gnt5 APN 16 19769213 missense probably damaging 1.00
IGL01503:B3gnt5 APN 16 19769781 missense probably damaging 1.00
IGL02623:B3gnt5 APN 16 19769610 missense probably damaging 1.00
IGL02978:B3gnt5 APN 16 19769994 missense probably damaging 1.00
IGL03355:B3gnt5 APN 16 19769153 missense probably benign 0.01
IGL03388:B3gnt5 APN 16 19770051 missense possibly damaging 0.83
R0180:B3gnt5 UTSW 16 19769100 missense possibly damaging 0.48
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0974:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R1034:B3gnt5 UTSW 16 19769484 missense probably damaging 1.00
R1435:B3gnt5 UTSW 16 19769174 missense probably damaging 0.99
R1480:B3gnt5 UTSW 16 19769867 missense probably damaging 1.00
R1533:B3gnt5 UTSW 16 19769614 missense probably damaging 1.00
R1920:B3gnt5 UTSW 16 19769544 missense probably benign 0.34
R3962:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R3963:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R4620:B3gnt5 UTSW 16 19769882 missense probably benign 0.37
R4948:B3gnt5 UTSW 16 19769144 missense probably benign
R4987:B3gnt5 UTSW 16 19769202 missense probably damaging 1.00
R6415:B3gnt5 UTSW 16 19770009 missense probably damaging 1.00
R7027:B3gnt5 UTSW 16 19769990 missense probably damaging 1.00
R7224:B3gnt5 UTSW 16 19769753 missense probably benign 0.06
R7261:B3gnt5 UTSW 16 19769373 missense probably damaging 1.00
R7369:B3gnt5 UTSW 16 19769660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTAATCGGGGAAGATCAAGTGTAC -3'
(R):5'- TTATTGGCACAGAGGCCCATG -3'

Sequencing Primer
(F):5'- GCAAGATTTCATTGATTCTTTCCAC -3'
(R):5'- GAGGCCCATGAATACATCATCTATG -3'
Posted On2016-06-06