Incidental Mutation 'R5028:Ror1'
ID391499
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100411936 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039630
AA Change: T324A

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: T324A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense not run
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGCCTGGAGAAAGACCTTC -3'
(R):5'- AGGTGACTGAATACATTAGAGCC -3'

Sequencing Primer
(F):5'- CCTTCCAGGTGCTTAGCC -3'
(R):5'- TACCACATGCTGGGATGTCAC -3'
Posted On2016-06-06