Incidental Mutation 'R5028:Tigd2'
ID391503
Institutional Source Beutler Lab
Gene Symbol Tigd2
Ensembl Gene ENSMUSG00000049232
Gene Nametigger transposable element derived 2
Synonyms3632410O17Rik
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location59208870-59212033 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 59211220 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 357 (W357*)
Ref Sequence ENSEMBL: ENSMUSP00000057223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062626]
Predicted Effect probably null
Transcript: ENSMUST00000062626
AA Change: W357*
SMART Domains Protein: ENSMUSP00000057223
Gene: ENSMUSG00000049232
AA Change: W357*

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-17 PFAM
CENPB 73 139 5.78e-19 SMART
Pfam:DDE_1 206 385 2.2e-52 PFAM
low complexity region 504 519 N/A INTRINSIC
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Tigd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Tigd2 APN 6 59211698 nonsense probably null
IGL03356:Tigd2 APN 6 59211705 missense probably benign 0.04
PIT1430001:Tigd2 UTSW 6 59211248 missense probably damaging 1.00
R0048:Tigd2 UTSW 6 59211384 missense possibly damaging 0.86
R0387:Tigd2 UTSW 6 59211158 missense probably benign 0.00
R0523:Tigd2 UTSW 6 59210373 missense probably benign 0.30
R0636:Tigd2 UTSW 6 59211287 missense possibly damaging 0.66
R1171:Tigd2 UTSW 6 59211376 missense possibly damaging 0.73
R2440:Tigd2 UTSW 6 59209995 start gained probably benign
R4327:Tigd2 UTSW 6 59210577 missense probably benign 0.36
R4731:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4732:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4733:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R5005:Tigd2 UTSW 6 59211146 missense probably benign 0.06
R5248:Tigd2 UTSW 6 59211153 missense probably damaging 1.00
R6006:Tigd2 UTSW 6 59210777 missense possibly damaging 0.45
R7099:Tigd2 UTSW 6 59210181 missense probably damaging 1.00
R7261:Tigd2 UTSW 6 59211067 missense probably benign 0.02
R7553:Tigd2 UTSW 6 59211579 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGCAGGGAAAGGCACAAAATT -3'
(R):5'- TCTTCAGTATTCTGCAAAACCGT -3'

Sequencing Primer
(F):5'- TGTGCAAATGCCACAGGTTC -3'
(R):5'- TTCCACGCTCTGGTTATG -3'
Posted On2016-06-06