Incidental Mutation 'R5028:Arhgap17'
ID391509
Institutional Source Beutler Lab
Gene Symbol Arhgap17
Ensembl Gene ENSMUSG00000030766
Gene NameRho GTPase activating protein 17
SynonymsNadrin2, Nadrin, WBP15, 5730403H17Rik, Rich1
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123279218-123369915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123294673 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 508 (H508L)
Ref Sequence ENSEMBL: ENSMUSP00000102050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098060] [ENSMUST00000106442] [ENSMUST00000167309] [ENSMUST00000205262] [ENSMUST00000206117] [ENSMUST00000207010]
Predicted Effect probably benign
Transcript: ENSMUST00000098060
SMART Domains Protein: ENSMUSP00000095668
Gene: ENSMUSG00000030766

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 554 595 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 644 664 N/A INTRINSIC
low complexity region 683 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106442
AA Change: H508L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102050
Gene: ENSMUSG00000030766
AA Change: H508L

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167309
AA Change: H508L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128447
Gene: ENSMUSG00000030766
AA Change: H508L

DomainStartEndE-ValueType
BAR 1 239 4.45e-65 SMART
RhoGAP 263 439 1.2e-60 SMART
low complexity region 542 557 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 632 673 N/A INTRINSIC
low complexity region 702 718 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205785
Predicted Effect probably benign
Transcript: ENSMUST00000206117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206294
Predicted Effect probably benign
Transcript: ENSMUST00000207010
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICH1 is a GTPase-activating protein (GAP). GAPs stimulate the intrinsic GTP hydrolysis of small G proteins, such as RHOA (MIM 165390), RAC1 (MIM 602048), and CDC42 (MIM 116952).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Arhgap17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Arhgap17 APN 7 123286568 utr 3 prime probably benign
IGL02112:Arhgap17 APN 7 123318417 missense possibly damaging 0.92
IGL02117:Arhgap17 APN 7 123286773 utr 3 prime probably benign
IGL03062:Arhgap17 APN 7 123321874 splice site probably null
gensing UTSW 7 123314690 missense probably damaging 1.00
tuberose UTSW 7 123308377 missense probably damaging 1.00
P0028:Arhgap17 UTSW 7 123286677 utr 3 prime probably benign
R0480:Arhgap17 UTSW 7 123294644 missense probably damaging 0.98
R0593:Arhgap17 UTSW 7 123286743 utr 3 prime probably benign
R0594:Arhgap17 UTSW 7 123294518 missense probably benign 0.00
R0599:Arhgap17 UTSW 7 123303790 splice site probably benign
R0751:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1184:Arhgap17 UTSW 7 123314690 missense probably damaging 1.00
R1791:Arhgap17 UTSW 7 123286702 missense probably benign 0.23
R2036:Arhgap17 UTSW 7 123318494 missense possibly damaging 0.92
R3428:Arhgap17 UTSW 7 123323631 missense probably damaging 1.00
R4032:Arhgap17 UTSW 7 123280066 utr 3 prime probably benign
R4119:Arhgap17 UTSW 7 123306994 missense probably damaging 1.00
R4652:Arhgap17 UTSW 7 123286618 utr 3 prime probably benign
R4687:Arhgap17 UTSW 7 123321603 missense probably damaging 1.00
R4910:Arhgap17 UTSW 7 123308377 missense probably damaging 1.00
R4960:Arhgap17 UTSW 7 123286926 utr 3 prime probably benign
R4963:Arhgap17 UTSW 7 123308360 missense possibly damaging 0.91
R5253:Arhgap17 UTSW 7 123303748 missense probably benign 0.00
R5316:Arhgap17 UTSW 7 123296527 missense possibly damaging 0.63
R5410:Arhgap17 UTSW 7 123297493 critical splice donor site probably null
R5890:Arhgap17 UTSW 7 123286758 utr 3 prime probably benign
R6367:Arhgap17 UTSW 7 123308363 makesense probably null
R6376:Arhgap17 UTSW 7 123300504 missense probably damaging 1.00
R6513:Arhgap17 UTSW 7 123292156 missense possibly damaging 0.87
R6862:Arhgap17 UTSW 7 123321901 missense probably damaging 0.98
R6962:Arhgap17 UTSW 7 123296432 missense probably damaging 1.00
R7077:Arhgap17 UTSW 7 123280008 missense unknown
R7178:Arhgap17 UTSW 7 123285358 intron probably null
R7205:Arhgap17 UTSW 7 123306438 missense probably damaging 1.00
R7342:Arhgap17 UTSW 7 123327244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAAGTGGGCTCCTTAC -3'
(R):5'- ATGACCGCTGACATGTCTTG -3'

Sequencing Primer
(F):5'- AAGTGGGCTCCTTACCTGCTG -3'
(R):5'- GCCACTTACCTGCATGCTGG -3'
Posted On2016-06-06