Incidental Mutation 'R5028:Comp'
ID391512
Institutional Source Beutler Lab
Gene Symbol Comp
Ensembl Gene ENSMUSG00000031849
Gene Namecartilage oligomeric matrix protein
Synonymsthrombospondin-5, TSP5
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70373558-70382066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70376640 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 289 (N289T)
Ref Sequence ENSEMBL: ENSMUSP00000003659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003659]
PDB Structure
Storage function of COMP:the crystal structure of the coiled-coil domain in complex with vitamin D3 [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003659
AA Change: N289T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003659
Gene: ENSMUSG00000031849
AA Change: N289T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:COMP 28 72 6.2e-22 PFAM
EGF 88 124 8.19e-2 SMART
EGF_CA 125 177 5.08e-7 SMART
EGF_CA 178 220 1.73e-9 SMART
EGF 226 265 7.53e-1 SMART
Pfam:TSP_3 299 334 6.1e-16 PFAM
Pfam:TSP_3 358 393 1.2e-15 PFAM
Pfam:TSP_3 393 416 2.7e-6 PFAM
Pfam:TSP_3 417 454 1.6e-14 PFAM
Pfam:TSP_3 455 490 3.7e-14 PFAM
Pfam:TSP_3 491 526 6.1e-15 PFAM
Pfam:TSP_C 544 741 2.6e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212439
Predicted Effect probably benign
Transcript: ENSMUST00000212488
Predicted Effect probably benign
Transcript: ENSMUST00000213072
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation are indistinguishable from controls. Mice homozygous for a knockin allele with two point mutations exhibit short limb dwarfism, osteoarthritis, abnormal chondrocytes, mild myopathy, and abnormal tendon morphology and stiffness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Comp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Comp APN 8 70378635 missense probably damaging 1.00
IGL02110:Comp APN 8 70373639 missense probably benign 0.08
IGL02721:Comp APN 8 70376081 missense probably damaging 1.00
IGL02812:Comp APN 8 70376687 missense possibly damaging 0.75
IGL03023:Comp APN 8 70378610 unclassified probably benign
IGL03047:Comp UTSW 8 70374909 missense possibly damaging 0.65
R0217:Comp UTSW 8 70378908 missense probably damaging 1.00
R0503:Comp UTSW 8 70375734 missense possibly damaging 0.58
R0659:Comp UTSW 8 70379101 missense possibly damaging 0.84
R1490:Comp UTSW 8 70373913 missense possibly damaging 0.63
R1663:Comp UTSW 8 70373600 missense possibly damaging 0.93
R1666:Comp UTSW 8 70378957 splice site probably null
R1668:Comp UTSW 8 70378957 splice site probably null
R1789:Comp UTSW 8 70377146 missense probably benign 0.01
R2096:Comp UTSW 8 70376063 missense probably damaging 1.00
R2157:Comp UTSW 8 70379570 nonsense probably null
R3836:Comp UTSW 8 70373859 missense probably benign 0.26
R4630:Comp UTSW 8 70374382 missense possibly damaging 0.94
R4743:Comp UTSW 8 70376061 missense probably damaging 1.00
R4747:Comp UTSW 8 70376702 missense probably damaging 1.00
R5070:Comp UTSW 8 70376495 missense probably benign 0.25
R5083:Comp UTSW 8 70381300 missense probably damaging 1.00
R5917:Comp UTSW 8 70376361 splice site probably null
R6705:Comp UTSW 8 70376737 missense probably damaging 0.98
R6965:Comp UTSW 8 70376514 missense probably damaging 1.00
R7309:Comp UTSW 8 70373678 intron probably null
R7402:Comp UTSW 8 70377204 missense probably benign 0.01
R7501:Comp UTSW 8 70379409 missense possibly damaging 0.82
R7541:Comp UTSW 8 70381350 missense probably damaging 1.00
R7568:Comp UTSW 8 70373859 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCCATGAGAAAGCAAACTGC -3'
(R):5'- AAGAAGGTCTGGTCCCTCTG -3'

Sequencing Primer
(F):5'- TCCGGCGTACGTGGACATTTC -3'
(R):5'- CCTCTGCTGGAAGCTAGATAACTAG -3'
Posted On2016-06-06