Incidental Mutation 'R5028:Yap1'
ID391515
Institutional Source Beutler Lab
Gene Symbol Yap1
Ensembl Gene ENSMUSG00000053110
Gene Nameyes-associated protein 1
SynonymsYki, Yap, yorkie
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5028 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7931999-8004596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8001689 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 99 (T99A)
Ref Sequence ENSEMBL: ENSMUSP00000134007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065353] [ENSMUST00000086580] [ENSMUST00000173085] [ENSMUST00000173264] [ENSMUST00000174577]
Predicted Effect probably benign
Transcript: ENSMUST00000065353
AA Change: T99A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000069554
Gene: ENSMUSG00000053110
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 4e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086580
AA Change: T99A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000083772
Gene: ENSMUSG00000053110
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172870
Predicted Effect probably benign
Transcript: ENSMUST00000173085
AA Change: T99A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134007
Gene: ENSMUSG00000053110
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173227
Predicted Effect probably benign
Transcript: ENSMUST00000173264
AA Change: T99A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134237
Gene: ENSMUSG00000053110
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174300
Predicted Effect probably benign
Transcript: ENSMUST00000174577
AA Change: T99A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133959
Gene: ENSMUSG00000053110
AA Change: T99A

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174604
AA Change: T5A
SMART Domains Protein: ENSMUSP00000134250
Gene: ENSMUSG00000053110
AA Change: T5A

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
WW 64 96 5.63e-12 SMART
WW 123 155 8.66e-13 SMART
coiled coil region 191 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211167
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Embryos homozygous for a null mutation of this gene die between embryonic days E9.5 and E10.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion. Heterozygous mice are viable, appear normal and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dact1 C A 12: 71,318,573 C709* probably null Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Yap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Yap1 APN 9 7934741 splice site probably benign
IGL01404:Yap1 APN 9 7934741 splice site probably benign
IGL02338:Yap1 APN 9 7962281 critical splice donor site probably null
IGL02398:Yap1 APN 9 7950535 missense probably benign 0.06
IGL02793:Yap1 APN 9 7973906 missense probably benign 0.44
Puddel_hunde UTSW 9 8004284 missense probably damaging 1.00
R0410:Yap1 UTSW 9 8001467 missense probably damaging 1.00
R1507:Yap1 UTSW 9 7953140 splice site probably benign
R1837:Yap1 UTSW 9 7962349 missense probably damaging 1.00
R3968:Yap1 UTSW 9 7973876 missense probably damaging 1.00
R3978:Yap1 UTSW 9 8004284 missense probably damaging 1.00
R4111:Yap1 UTSW 9 7938431 makesense probably null
R4113:Yap1 UTSW 9 7938431 makesense probably null
R4573:Yap1 UTSW 9 7934681 missense probably damaging 1.00
R6397:Yap1 UTSW 9 8001466 missense probably damaging 1.00
R6407:Yap1 UTSW 9 7962372 missense possibly damaging 0.46
X0020:Yap1 UTSW 9 7938435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCATCAGGGATCTCAAAGGAGG -3'
(R):5'- GAGGTAGACATTCATCCAGATGG -3'

Sequencing Primer
(F):5'- TCTCAAAGGAGGACTGCCG -3'
(R):5'- TGTAATGGTCTATTTGGTCTGGTG -3'
Posted On2016-06-06