Incidental Mutation 'R5028:Dcxr'
ID 391523
Institutional Source Beutler Lab
Gene Symbol Dcxr
Ensembl Gene ENSMUSG00000039450
Gene Name dicarbonyl L-xylulose reductase
Synonyms 1810027P18Rik, 0610038K04Rik
MMRRC Submission 042619-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5028 (G1)
Quality Score 195
Status Validated
Chromosome 11
Chromosomal Location 120616225-120618107 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 120617273 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 90 (Q90P)
Ref Sequence ENSEMBL: ENSMUSP00000101754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148] [ENSMUST00000142229]
AlphaFold Q91X52
Predicted Effect probably benign
Transcript: ENSMUST00000018156
SMART Domains Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 179 8.8e-139 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000026144
AA Change: Q90P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450
AA Change: Q90P

DomainStartEndE-ValueType
Pfam:adh_short 8 195 8.9e-51 PFAM
Pfam:KR 9 175 7.1e-9 PFAM
Pfam:Epimerase 10 227 2.3e-7 PFAM
Pfam:adh_short_C2 14 242 6.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026148
SMART Domains Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:KR 9 178 8.5e-8 PFAM
Pfam:adh_short 9 195 4.6e-55 PFAM
Pfam:adh_short_C2 14 242 9.4e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106148
AA Change: Q90P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450
AA Change: Q90P

DomainStartEndE-ValueType
Pfam:adh_short 8 151 2.1e-22 PFAM
Pfam:KR 9 151 4.7e-7 PFAM
Pfam:NAD_binding_10 11 182 3.9e-9 PFAM
Pfam:adh_short_C2 14 150 2.2e-8 PFAM
Pfam:adh_short_C2 157 234 4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154479
Predicted Effect probably benign
Transcript: ENSMUST00000154565
SMART Domains Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150

DomainStartEndE-ValueType
Pfam:adh_short 1 45 6.2e-10 PFAM
Pfam:adh_short_C2 33 154 9.7e-18 PFAM
Pfam:adh_short 41 123 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142229
SMART Domains Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

DomainStartEndE-ValueType
RHO 6 172 3.19e-127 SMART
Meta Mutation Damage Score 0.5729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,104,356 (GRCm39) S777C probably damaging Het
Ano5 T A 7: 51,187,458 (GRCm39) probably null Het
Arhgap17 T A 7: 122,893,896 (GRCm39) H508L probably benign Het
Arhgap29 T A 3: 121,803,709 (GRCm39) probably null Het
Atp12a T C 14: 56,624,435 (GRCm39) F961S probably damaging Het
B4galnt4 C A 7: 140,647,975 (GRCm39) P497Q probably benign Het
Camsap1 A G 2: 25,834,568 (GRCm39) S364P probably damaging Het
Ccdc150 C A 1: 54,302,636 (GRCm39) D85E probably benign Het
Cdc45 A G 16: 18,613,930 (GRCm39) Y291H probably benign Het
Comp A C 8: 70,829,290 (GRCm39) N289T probably damaging Het
Cops3 T A 11: 59,708,856 (GRCm39) probably benign Het
Crybg1 G A 10: 43,874,208 (GRCm39) H967Y possibly damaging Het
Csmd1 A T 8: 16,039,090 (GRCm39) F2423I probably damaging Het
Dact1 C A 12: 71,365,347 (GRCm39) C709* probably null Het
Ell A G 8: 71,043,349 (GRCm39) Y494C probably damaging Het
Emilin2 T C 17: 71,581,727 (GRCm39) E333G possibly damaging Het
Eml2 T C 7: 18,913,372 (GRCm39) probably null Het
Fam186b T A 15: 99,178,682 (GRCm39) M215L probably damaging Het
Gm17078 T A 14: 51,848,699 (GRCm39) R13W probably null Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Hspa14 A G 2: 3,499,206 (GRCm39) F196S possibly damaging Het
Ier5 A G 1: 154,974,849 (GRCm39) S110P possibly damaging Het
Kif1a T A 1: 92,982,049 (GRCm39) I793F possibly damaging Het
Lrrc43 T C 5: 123,646,176 (GRCm39) I643T probably damaging Het
Map3k19 A T 1: 127,750,969 (GRCm39) L794Q probably benign Het
Meox2 A T 12: 37,158,935 (GRCm39) M36L probably benign Het
Mgat5b T A 11: 116,875,855 (GRCm39) L693Q probably damaging Het
Mup4 T A 4: 59,958,124 (GRCm39) E148V possibly damaging Het
Napb T C 2: 148,545,057 (GRCm39) N162S possibly damaging Het
Nlgn2 T C 11: 69,718,563 (GRCm39) D339G probably benign Het
Nucks1 C T 1: 131,855,840 (GRCm39) R90C possibly damaging Het
Or11g7 T C 14: 50,691,196 (GRCm39) V229A probably damaging Het
Or5an9 T A 19: 12,187,518 (GRCm39) V196E possibly damaging Het
Plekhd1 A T 12: 80,739,723 (GRCm39) D24V probably damaging Het
Prpf4b C T 13: 35,083,958 (GRCm39) P909L probably damaging Het
Rasgrp1 T A 2: 117,132,485 (GRCm39) K116* probably null Het
Ror1 A G 4: 100,269,133 (GRCm39) T324A possibly damaging Het
Slc24a4 G A 12: 102,230,629 (GRCm39) G505R probably damaging Het
Slc8a1 A G 17: 81,956,702 (GRCm39) I112T possibly damaging Het
Smarcc2 A G 10: 128,297,314 (GRCm39) S69G probably damaging Het
Smc2 A T 4: 52,458,447 (GRCm39) E429D probably damaging Het
Sry T C Y: 2,663,312 (GRCm39) D116G probably damaging Het
Tcea3 T A 4: 135,985,246 (GRCm39) V154E possibly damaging Het
Tigd2 G A 6: 59,188,205 (GRCm39) W357* probably null Het
Tmem177 T A 1: 119,838,419 (GRCm39) T87S probably benign Het
Treh A T 9: 44,594,186 (GRCm39) E144V probably null Het
Trpm6 T A 19: 18,764,124 (GRCm39) D243E probably damaging Het
Ttn T C 2: 76,608,394 (GRCm39) D17843G probably damaging Het
Vars2 A C 17: 35,970,365 (GRCm39) probably null Het
Vmn1r201 G A 13: 22,659,530 (GRCm39) W248* probably null Het
Yap1 T C 9: 8,001,690 (GRCm39) T99A probably benign Het
Zbtb8b C A 4: 129,326,793 (GRCm39) C91F probably damaging Het
Zfp882 A G 8: 72,668,498 (GRCm39) T442A possibly damaging Het
Zxdc G T 6: 90,359,320 (GRCm39) G651C probably benign Het
Other mutations in Dcxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Dcxr APN 11 120,616,993 (GRCm39) missense possibly damaging 0.75
IGL01516:Dcxr APN 11 120,616,584 (GRCm39) splice site probably null
IGL02151:Dcxr APN 11 120,616,809 (GRCm39) missense probably benign 0.00
IGL03264:Dcxr APN 11 120,617,298 (GRCm39) missense probably damaging 1.00
R0890:Dcxr UTSW 11 120,617,297 (GRCm39) missense probably damaging 1.00
R1325:Dcxr UTSW 11 120,617,381 (GRCm39) splice site probably null
R1808:Dcxr UTSW 11 120,616,438 (GRCm39) splice site probably null
R2099:Dcxr UTSW 11 120,616,403 (GRCm39) missense probably damaging 1.00
R2102:Dcxr UTSW 11 120,617,133 (GRCm39) missense probably benign 0.08
R4602:Dcxr UTSW 11 120,617,130 (GRCm39) missense possibly damaging 0.49
R4772:Dcxr UTSW 11 120,616,923 (GRCm39) missense probably benign 0.00
R5219:Dcxr UTSW 11 120,616,314 (GRCm39) unclassified probably benign
R5336:Dcxr UTSW 11 120,618,002 (GRCm39) critical splice donor site probably null
R5518:Dcxr UTSW 11 120,617,025 (GRCm39) unclassified probably benign
R6613:Dcxr UTSW 11 120,617,832 (GRCm39) missense probably benign 0.00
R6833:Dcxr UTSW 11 120,616,917 (GRCm39) missense probably damaging 1.00
R7042:Dcxr UTSW 11 120,617,841 (GRCm39) missense possibly damaging 0.66
R7531:Dcxr UTSW 11 120,617,832 (GRCm39) missense probably benign 0.00
R7633:Dcxr UTSW 11 120,617,279 (GRCm39) missense probably benign 0.00
R7710:Dcxr UTSW 11 120,617,908 (GRCm39) missense probably benign 0.08
R9128:Dcxr UTSW 11 120,617,372 (GRCm39) missense
R9800:Dcxr UTSW 11 120,618,084 (GRCm39) unclassified probably benign
Z1176:Dcxr UTSW 11 120,618,034 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGATGACAGCCCGAAGATTC -3'
(R):5'- GTCCAGTTTTCCCAGACTGC -3'

Sequencing Primer
(F):5'- GCCCGAAGATTCACATTGAAGGATC -3'
(R):5'- CACCTTAGGACACAATTGCAGG -3'
Posted On 2016-06-06