Incidental Mutation 'R5028:Dact1'
ID391525
Institutional Source Beutler Lab
Gene Symbol Dact1
Ensembl Gene ENSMUSG00000044548
Gene Namedishevelled-binding antagonist of beta-catenin 1
SynonymsFrodo, Dapper1, Frodo1, THYEX3, Frd1
MMRRC Submission 042619-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5028 (G1)
Quality Score189
Status Validated
Chromosome12
Chromosomal Location71309884-71320107 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 71318573 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 709 (C709*)
Ref Sequence ENSEMBL: ENSMUSP00000117169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061273] [ENSMUST00000150639]
Predicted Effect probably null
Transcript: ENSMUST00000061273
AA Change: C672*
SMART Domains Protein: ENSMUSP00000058943
Gene: ENSMUSG00000044548
AA Change: C672*

DomainStartEndE-ValueType
Pfam:Dapper 39 206 4.1e-83 PFAM
Pfam:Dapper 204 778 7.8e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132822
Predicted Effect probably null
Transcript: ENSMUST00000150639
AA Change: C709*
SMART Domains Protein: ENSMUSP00000117169
Gene: ENSMUSG00000044548
AA Change: C709*

DomainStartEndE-ValueType
Pfam:Dapper 39 815 1.4e-240 PFAM
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, abnormal embryogenesis, blind-ended colons, and abnormal renal/urinary system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T A 2: 69,274,012 S777C probably damaging Het
Ano5 T A 7: 51,537,710 probably null Het
Arhgap17 T A 7: 123,294,673 H508L probably benign Het
Arhgap29 T A 3: 122,010,060 probably null Het
Atp12a T C 14: 56,386,978 F961S probably damaging Het
B4galnt4 C A 7: 141,068,062 P497Q probably benign Het
Camsap1 A G 2: 25,944,556 S364P probably damaging Het
Ccdc150 C A 1: 54,263,477 D85E probably benign Het
Cdc45 A G 16: 18,795,180 Y291H probably benign Het
Comp A C 8: 70,376,640 N289T probably damaging Het
Cops3 T A 11: 59,818,030 probably benign Het
Crybg1 G A 10: 43,998,212 H967Y possibly damaging Het
Csmd1 A T 8: 15,989,090 F2423I probably damaging Het
Dcxr T G 11: 120,726,447 Q90P probably damaging Het
Ell A G 8: 70,590,699 Y494C probably damaging Het
Emilin2 T C 17: 71,274,732 E333G possibly damaging Het
Eml2 T C 7: 19,179,447 probably null Het
Fam186b T A 15: 99,280,801 M215L probably damaging Het
Gm17078 T A 14: 51,611,242 R13W probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Hspa14 A G 2: 3,498,169 F196S possibly damaging Het
Ier5 A G 1: 155,099,103 S110P possibly damaging Het
Kif1a T A 1: 93,054,327 I793F possibly damaging Het
Lrrc43 T C 5: 123,508,113 I643T probably damaging Het
Map3k19 A T 1: 127,823,232 L794Q probably benign Het
Meox2 A T 12: 37,108,936 M36L probably benign Het
Mgat5b T A 11: 116,985,029 L693Q probably damaging Het
Mup4 T A 4: 59,958,124 E148V possibly damaging Het
Napb T C 2: 148,703,137 N162S possibly damaging Het
Nlgn2 T C 11: 69,827,737 D339G probably benign Het
Nucks1 C T 1: 131,928,102 R90C possibly damaging Het
Olfr1431 T A 19: 12,210,154 V196E possibly damaging Het
Olfr740 T C 14: 50,453,739 V229A probably damaging Het
Plekhd1 A T 12: 80,692,949 D24V probably damaging Het
Prpf4b C T 13: 34,899,975 P909L probably damaging Het
Rasgrp1 T A 2: 117,302,004 K116* probably null Het
Ror1 A G 4: 100,411,936 T324A possibly damaging Het
Slc24a4 G A 12: 102,264,370 G505R probably damaging Het
Slc8a1 A G 17: 81,649,273 I112T possibly damaging Het
Smarcc2 A G 10: 128,461,445 S69G probably damaging Het
Smc2 A T 4: 52,458,447 E429D probably damaging Het
Sry T C Y: 2,663,312 D116G probably damaging Het
Tcea3 T A 4: 136,257,935 V154E possibly damaging Het
Tigd2 G A 6: 59,211,220 W357* probably null Het
Tmem177 T A 1: 119,910,689 T87S probably benign Het
Treh A T 9: 44,682,889 E144V probably null Het
Trpm6 T A 19: 18,786,760 D243E probably damaging Het
Ttn T C 2: 76,778,050 D17843G probably damaging Het
Vars2 A C 17: 35,659,473 probably null Het
Vmn1r201 G A 13: 22,475,360 W248* probably null Het
Yap1 T C 9: 8,001,689 T99A probably benign Het
Zbtb8b C A 4: 129,433,000 C91F probably damaging Het
Zfp882 A G 8: 71,914,654 T442A possibly damaging Het
Zxdc G T 6: 90,382,338 G651C probably benign Het
Other mutations in Dact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Dact1 APN 12 71317483 missense probably damaging 1.00
R0930:Dact1 UTSW 12 71318460 missense probably damaging 1.00
R1590:Dact1 UTSW 12 71317575 missense probably benign 0.34
R1669:Dact1 UTSW 12 71318773 missense probably damaging 1.00
R1694:Dact1 UTSW 12 71312777 missense probably damaging 1.00
R1826:Dact1 UTSW 12 71318344 missense probably damaging 1.00
R4398:Dact1 UTSW 12 71317185 missense probably damaging 1.00
R5917:Dact1 UTSW 12 71318682 missense possibly damaging 0.75
R6432:Dact1 UTSW 12 71318553 missense probably damaging 1.00
R6473:Dact1 UTSW 12 71317698 missense probably benign 0.00
R6759:Dact1 UTSW 12 71318137 nonsense probably null
R6823:Dact1 UTSW 12 71317939 missense probably benign 0.10
R7564:Dact1 UTSW 12 71318551 missense probably damaging 1.00
X0025:Dact1 UTSW 12 71317852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGACGACTCGGATAC -3'
(R):5'- TGGACAAACTGGGACCAGATTAAAC -3'

Sequencing Primer
(F):5'- TGGTGGCCAAACCGAAGC -3'
(R):5'- TGGGACCAGATTAAACCCCCG -3'
Posted On2016-06-06