Incidental Mutation 'R0441:Otog'
ID39164
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R0441 (G1)
Quality Score209
Status Validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46305877 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 564 (S564P)
Ref Sequence ENSEMBL: ENSMUSP00000147899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538] [ENSMUST00000209802]
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: S2749P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: S2749P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209802
AA Change: S564P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTGCTCCAGAAATGGAATCTC -3'
(R):5'- AGCATGGCCTGAAGACATGTAGAAC -3'

Sequencing Primer
(F):5'- ATGGAATCTCTAGCAGGCATC -3'
(R):5'- CATGTAGAACCCAGGACCAGG -3'
Posted On2013-05-23