Incidental Mutation 'R5031:Olfr1115'
ID391679
Institutional Source Beutler Lab
Gene Symbol Olfr1115
Ensembl Gene ENSMUSG00000070856
Gene Nameolfactory receptor 1115
SynonymsMOR264-20, MOR273-4P, MOR273-4P, Olfr1530-ps1, GA_x6K02T2Q125-48736906-48737886
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5031 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87248013-87253868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87252082 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 48 (F48L)
Ref Sequence ENSEMBL: ENSMUSP00000150996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081986] [ENSMUST00000213513] [ENSMUST00000214119] [ENSMUST00000217196]
Predicted Effect probably benign
Transcript: ENSMUST00000081986
AA Change: F48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080647
Gene: ENSMUSG00000070856
AA Change: F48L

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5e-54 PFAM
Pfam:7tm_1 56 305 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183480
Predicted Effect probably benign
Transcript: ENSMUST00000213513
AA Change: F48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214119
AA Change: F48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217196
AA Change: F48L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Olfr1115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1115 APN 2 87252462 missense probably damaging 1.00
IGL01376:Olfr1115 APN 2 87252873 missense possibly damaging 0.58
IGL02167:Olfr1115 APN 2 87252198 missense probably benign 0.18
IGL02224:Olfr1115 APN 2 87252477 missense probably benign 0.42
IGL02388:Olfr1115 APN 2 87251951 missense probably benign
IGL02596:Olfr1115 APN 2 87252129 missense probably damaging 0.98
PIT4131001:Olfr1115 UTSW 2 87252629 missense probably benign 0.01
R0140:Olfr1115 UTSW 2 87252625 missense probably damaging 1.00
R0468:Olfr1115 UTSW 2 87252255 missense probably benign 0.04
R1222:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1418:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1742:Olfr1115 UTSW 2 87252778 missense probably benign 0.01
R1822:Olfr1115 UTSW 2 87252710 missense possibly damaging 0.91
R2332:Olfr1115 UTSW 2 87252873 missense possibly damaging 0.58
R3123:Olfr1115 UTSW 2 87252791 missense possibly damaging 0.67
R3407:Olfr1115 UTSW 2 87252899 missense probably benign 0.00
R4571:Olfr1115 UTSW 2 87252458 missense possibly damaging 0.67
R4710:Olfr1115 UTSW 2 87252040 missense possibly damaging 0.64
R4889:Olfr1115 UTSW 2 87252647 missense probably damaging 0.97
R5288:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5385:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5386:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5669:Olfr1115 UTSW 2 87252441 missense probably benign 0.00
R6187:Olfr1115 UTSW 2 87252698 missense probably damaging 1.00
R6226:Olfr1115 UTSW 2 87252392 missense probably benign 0.27
R6598:Olfr1115 UTSW 2 87252756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTTCCAGAGACATCACGCAG -3'
(R):5'- TCCTTTCAGTGTGAAGAGATCC -3'

Sequencing Primer
(F):5'- GTTGTAAAGACTGAAACACAATCCC -3'
(R):5'- CAGTGTGAAGAGATCCATAAGCATTC -3'
Posted On2016-06-06