Incidental Mutation 'R5031:Tram1l1'
ID391680
Institutional Source Beutler Lab
Gene Symbol Tram1l1
Ensembl Gene ENSMUSG00000044528
Gene Nametranslocation associated membrane protein 1-like 1
Synonyms
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5031 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location124320855-124324743 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 124321644 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 151 (L151*)
Ref Sequence ENSEMBL: ENSMUSP00000062635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058994]
Predicted Effect probably null
Transcript: ENSMUST00000058994
AA Change: L151*
SMART Domains Protein: ENSMUSP00000062635
Gene: ENSMUSG00000044528
AA Change: L151*

DomainStartEndE-ValueType
Pfam:TRAM1 47 114 4.2e-21 PFAM
TLC 116 324 1.73e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196150
Meta Mutation Damage Score 0.6376 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Tram1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Tram1l1 APN 3 124322139 missense probably benign 0.00
IGL02385:Tram1l1 APN 3 124322058 missense probably benign 0.25
IGL03212:Tram1l1 APN 3 124321914 missense possibly damaging 0.89
R1440:Tram1l1 UTSW 3 124321931 nonsense probably null
R1929:Tram1l1 UTSW 3 124321986 missense probably damaging 1.00
R2007:Tram1l1 UTSW 3 124321839 missense possibly damaging 0.89
R4623:Tram1l1 UTSW 3 124321860 missense possibly damaging 0.47
R5091:Tram1l1 UTSW 3 124321751 missense possibly damaging 0.69
R6142:Tram1l1 UTSW 3 124321443 missense probably damaging 1.00
R7469:Tram1l1 UTSW 3 124321240 missense probably benign 0.02
X0062:Tram1l1 UTSW 3 124322094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGCTGGTGGCCATCATC -3'
(R):5'- CCCAAGTGGTTCAAGTACAAGAG -3'

Sequencing Primer
(F):5'- GTGGCCATCATCATCCACG -3'
(R):5'- AGAGATAGGCCCCTCCAATGTG -3'
Posted On2016-06-06