Incidental Mutation 'R5031:Dmkn'
ID391689
Institutional Source Beutler Lab
Gene Symbol Dmkn
Ensembl Gene ENSMUSG00000060962
Gene Namedermokine
Synonymssk30, 1110014F24Rik, sk89, Dmkn, cI-36, dermokine
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5031 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30763756-30781063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30764236 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 105 (I105V)
Ref Sequence ENSEMBL: ENSMUSP00000082831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054427] [ENSMUST00000085688] [ENSMUST00000085691] [ENSMUST00000165887] [ENSMUST00000188578]
Predicted Effect unknown
Transcript: ENSMUST00000054427
AA Change: I105V
SMART Domains Protein: ENSMUSP00000060362
Gene: ENSMUSG00000060962
AA Change: I105V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 5.96e-5 PROSPERO
internal_repeat_2 25 53 3.87e-5 PROSPERO
internal_repeat_2 45 73 3.87e-5 PROSPERO
internal_repeat_3 65 94 5.96e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 312 331 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
internal_repeat_1 387 414 3.28e-7 PROSPERO
internal_repeat_1 422 449 3.28e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085688
AA Change: I105V

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082831
Gene: ENSMUSG00000060962
AA Change: I105V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.61e-5 PROSPERO
internal_repeat_2 25 53 4.31e-5 PROSPERO
internal_repeat_2 45 73 4.31e-5 PROSPERO
internal_repeat_3 65 94 6.61e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 308 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
internal_repeat_1 363 390 3.84e-7 PROSPERO
internal_repeat_1 398 425 3.84e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085691
AA Change: I105V

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082834
Gene: ENSMUSG00000060962
AA Change: I105V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.12e-5 PROSPERO
internal_repeat_2 25 53 3.97e-5 PROSPERO
internal_repeat_2 45 73 3.97e-5 PROSPERO
internal_repeat_3 65 94 6.12e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 350 N/A INTRINSIC
internal_repeat_1 378 405 3.43e-7 PROSPERO
internal_repeat_1 413 440 3.43e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000165887
AA Change: I105V

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129031
Gene: ENSMUSG00000060962
AA Change: I105V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_2 25 53 9.56e-5 PROSPERO
internal_repeat_2 45 73 9.56e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
internal_repeat_1 394 421 1.01e-6 PROSPERO
internal_repeat_1 429 456 1.01e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000188578
SMART Domains Protein: ENSMUSP00000140196
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
low complexity region 5 102 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
internal_repeat_1 173 200 3.77e-7 PROSPERO
internal_repeat_1 208 235 3.77e-7 PROSPERO
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ifitm5 G A 7: 140,950,104 R36* probably null Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Dmkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Dmkn APN 7 30778270 critical splice donor site probably null
IGL03084:Dmkn APN 7 30771056 missense possibly damaging 0.82
IGL03376:Dmkn APN 7 30771242 missense possibly damaging 0.92
R0077:Dmkn UTSW 7 30765294 missense probably benign 0.00
R0718:Dmkn UTSW 7 30764786 unclassified probably benign
R0892:Dmkn UTSW 7 30767404 missense probably damaging 1.00
R1163:Dmkn UTSW 7 30765051 missense probably damaging 1.00
R1858:Dmkn UTSW 7 30764565 missense probably benign 0.08
R2915:Dmkn UTSW 7 30765316 missense unknown
R4705:Dmkn UTSW 7 30763981 missense probably damaging 1.00
R4806:Dmkn UTSW 7 30771242 missense possibly damaging 0.92
R4921:Dmkn UTSW 7 30771233 missense probably damaging 0.99
R5056:Dmkn UTSW 7 30764104 missense probably damaging 1.00
R5577:Dmkn UTSW 7 30764546 missense probably damaging 1.00
R5780:Dmkn UTSW 7 30777615 missense probably damaging 1.00
R6233:Dmkn UTSW 7 30779679 missense probably damaging 0.99
R6504:Dmkn UTSW 7 30776429 missense possibly damaging 0.82
R7383:Dmkn UTSW 7 30765368 missense unknown
X0067:Dmkn UTSW 7 30778227 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTAGCCATGGAATTGGAGAGGC -3'
(R):5'- TCCAGATGTCCCCTGCAAAG -3'

Sequencing Primer
(F):5'- CATGGAATTGGAGAGGCTGTGG -3'
(R):5'- GTCCTTAGTCTGACAACCATGAGAG -3'
Posted On2016-06-06