Incidental Mutation 'R5031:Ifitm5'
ID391695
Institutional Source Beutler Lab
Gene Symbol Ifitm5
Ensembl Gene ENSMUSG00000025489
Gene Nameinterferon induced transmembrane protein 5
SynonymsHrmp1, Bril, 1110003J06Rik, fragilis4
MMRRC Submission 042622-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.636) question?
Stock #R5031 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140948958-140950291 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 140950104 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 36 (R36*)
Ref Sequence ENSEMBL: ENSMUSP00000026562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000081649] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably null
Transcript: ENSMUST00000026562
AA Change: R36*
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489
AA Change: R36*

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079403
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081649
SMART Domains Protein: ENSMUSP00000071470
Gene: ENSMUSG00000060591

DomainStartEndE-ValueType
Pfam:CD225 46 120 6.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164337
SMART Domains Protein: ENSMUSP00000127119
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 219 464 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164580
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169736
Predicted Effect probably benign
Transcript: ENSMUST00000211129
Meta Mutation Damage Score 0.702 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 89.9%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein thought to play a role in bone mineralization. This gene is located on chromosome 11 in a cluster of related genes which are induced by interferon, however, this gene has not been shown to be interferon inducible. A similar gene, located in a gene cluster on mouse chromosome 7, is a member of the interferon-inducible fragilis gene family. The mouse gene encodes a transmembrane protein described as participating in germ cell competence. A mutation in the 5' UTR of this gene has been associated with osteogenesis imperfecta type V (PMID: 22863190, 22863195). [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice exhbit smaller skeletons, partial prenatal and postnatal lethality, and small litter sizes. Mice that survive to adulthood still exhibit shorter bones but other skeletal defects are no longer seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,664,514 N136S probably damaging Het
Abca13 A T 11: 9,297,678 N2475I probably damaging Het
Acnat2 T C 4: 49,380,631 K231R probably damaging Het
Ank1 C T 8: 23,099,680 P599L probably damaging Het
Arhgef19 A G 4: 141,250,810 E580G probably damaging Het
Atr A G 9: 95,865,702 K346E probably damaging Het
AU021092 T C 16: 5,212,604 K309E probably damaging Het
Baz2b T C 2: 59,912,807 R1607G probably benign Het
Cct8 C T 16: 87,487,538 V254M probably damaging Het
Cdca2 T A 14: 67,713,153 I110F probably damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Dmkn A G 7: 30,764,236 I105V probably benign Het
Dock1 A G 7: 135,152,246 D1584G probably benign Het
Epg5 G A 18: 78,028,948 V2392I probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gsap G A 5: 21,242,826 S294N possibly damaging Het
Hectd2 A G 19: 36,599,604 N142D probably damaging Het
Hmcn1 A G 1: 150,588,257 C5091R probably damaging Het
Ints2 G A 11: 86,256,200 P40L probably damaging Het
Irs1 A T 1: 82,286,967 L1176* probably null Het
Klhl29 C T 12: 5,091,334 R550Q probably benign Het
Kyat1 A G 2: 30,188,090 M134T probably damaging Het
Lrrk2 A T 15: 91,700,619 N384Y possibly damaging Het
Magel2 T C 7: 62,380,104 S919P unknown Het
Mettl16 A T 11: 74,802,999 I279F probably benign Het
Mrgpra1 A T 7: 47,335,237 Y231* probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mut T C 17: 40,938,827 F231S possibly damaging Het
Mvp A C 7: 126,993,616 Y374* probably null Het
Nabp2 G A 10: 128,409,628 probably benign Het
Nos1 C T 5: 117,879,313 P247L probably benign Het
Olfr1015 T A 2: 85,785,718 L69* probably null Het
Olfr1115 C A 2: 87,252,082 F48L probably benign Het
Pik3cb C T 9: 99,071,408 D441N probably damaging Het
Qrich1 C T 9: 108,541,736 P464S possibly damaging Het
Rab17 A T 1: 90,960,138 probably null Het
Rspo3 A T 10: 29,506,447 L77H probably damaging Het
Spn G T 7: 127,137,230 T35K probably benign Het
Sult1d1 T A 5: 87,559,844 Y139F possibly damaging Het
Tbc1d32 C A 10: 56,123,531 Q848H probably damaging Het
Tcaf3 A G 6: 42,596,933 V115A probably benign Het
Tram1l1 T A 3: 124,321,644 L151* probably null Het
Trappc12 T A 12: 28,692,513 I682L possibly damaging Het
Trav6d-4 A C 14: 52,753,599 T31P probably damaging Het
Trpm8 A G 1: 88,348,188 T503A probably benign Het
Virma T A 4: 11,542,116 Y1567* probably null Het
Vmn1r228 T A 17: 20,776,681 K192* probably null Het
Zfp521 T A 18: 13,844,273 T1028S possibly damaging Het
Zfp583 T A 7: 6,317,398 Q205L probably benign Het
Other mutations in Ifitm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ifitm5 APN 7 140950163 missense probably benign 0.43
R0265:Ifitm5 UTSW 7 140950008 intron probably benign
R4199:Ifitm5 UTSW 7 140949236 makesense probably null
R4793:Ifitm5 UTSW 7 140950164 missense probably benign 0.01
R6909:Ifitm5 UTSW 7 140949259 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GACCTTCCTTTCCTGTGAACAG -3'
(R):5'- GCTATAAGCAGGCTTGGTGC -3'

Sequencing Primer
(F):5'- CCAAACTTGGTGAGGTACTGTG -3'
(R):5'- TGCTCAGAGAGGACAAGTCTC -3'
Posted On2016-06-06