Incidental Mutation 'R5032:Gmps'
ID391737
Institutional Source Beutler Lab
Gene Symbol Gmps
Ensembl Gene ENSMUSG00000027823
Gene Nameguanine monophosphate synthetase
SynonymsGm9479
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5032 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63976106-64022579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63990325 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 233 (K233E)
Ref Sequence ENSEMBL: ENSMUSP00000029405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029405]
Predicted Effect probably benign
Transcript: ENSMUST00000029405
AA Change: K233E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029405
Gene: ENSMUSG00000027823
AA Change: K233E

DomainStartEndE-ValueType
Pfam:GATase 29 210 6.3e-42 PFAM
Pfam:Peptidase_C26 91 192 1.9e-14 PFAM
Pfam:NAD_synthase 219 339 2.8e-10 PFAM
Pfam:Asn_synthase 231 315 3.9e-6 PFAM
Pfam:tRNA_Me_trans 237 318 1.1e-6 PFAM
Pfam:QueC 238 353 5.3e-9 PFAM
Pfam:GMP_synt_C 492 692 1.4e-32 PFAM
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the de novo synthesis of purine nucleotides, IMP is the branch point metabolite at which point the pathway diverges to the synthesis of either guanine or adenine nucleotides. In the guanine nucleotide pathway, there are 2 enzymes involved in converting IMP to GMP, namely IMP dehydrogenase (IMPD1), which catalyzes the oxidation of IMP to XMP, and GMP synthetase, which catalyzes the amination of XMP to GMP. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Gmps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Gmps APN 3 64014367 missense probably benign
IGL01341:Gmps APN 3 64015440 missense probably damaging 1.00
IGL01369:Gmps APN 3 64001592 missense probably benign 0.00
IGL02332:Gmps APN 3 63990569 missense probably benign 0.01
IGL02481:Gmps APN 3 64014352 missense probably damaging 1.00
IGL02483:Gmps APN 3 64014352 missense probably damaging 1.00
IGL03173:Gmps APN 3 63990329 missense probably damaging 0.98
K3955:Gmps UTSW 3 64001533 missense probably damaging 1.00
R0089:Gmps UTSW 3 63998698 missense probably benign 0.20
R0165:Gmps UTSW 3 63993954 missense probably damaging 1.00
R0466:Gmps UTSW 3 63993944 missense probably damaging 0.97
R0940:Gmps UTSW 3 63976322 splice site probably benign
R1686:Gmps UTSW 3 63985654 missense probably damaging 1.00
R1872:Gmps UTSW 3 64001517 missense probably benign 0.15
R1924:Gmps UTSW 3 63998628 missense probably damaging 1.00
R2229:Gmps UTSW 3 64014263 nonsense probably null
R3014:Gmps UTSW 3 64015436 missense possibly damaging 0.79
R3800:Gmps UTSW 3 63982445 missense possibly damaging 0.48
R4118:Gmps UTSW 3 63980194 missense probably benign 0.00
R4293:Gmps UTSW 3 63990619 missense probably damaging 0.99
R4596:Gmps UTSW 3 63993917 nonsense probably null
R4665:Gmps UTSW 3 64001535 missense probably benign 0.11
R6045:Gmps UTSW 3 63980137 missense probably benign
R6153:Gmps UTSW 3 64001543 missense probably benign 0.00
R6985:Gmps UTSW 3 64015539 missense probably damaging 1.00
R7188:Gmps UTSW 3 64011561 missense probably damaging 0.97
X0063:Gmps UTSW 3 63996850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGAAGGTATAGCCAATGAATC -3'
(R):5'- AGTTGAATCTACACCACCACTG -3'

Sequencing Primer
(F):5'- GCCAATGAATCTAAAAAGCTATACGG -3'
(R):5'- TCTACACCACCACTGAGTAAAACCTG -3'
Posted On2016-06-06