Incidental Mutation 'R5032:1700012B07Rik'
List |< first << previous [record 56 of 18188] next >> last >|
ID391773
Institutional Source Beutler Lab
Gene Symbol 1700012B07Rik
Ensembl Gene ENSMUSG00000020617
Gene NameRIKEN cDNA 1700012B07 gene
Synonyms
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R5032 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location109787651-109828046 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 109794154 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 172 (C172*)
Ref Sequence ENSEMBL: ENSMUSP00000102285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]
Predicted Effect probably null
Transcript: ENSMUST00000020941
AA Change: C172*
SMART Domains Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106674
AA Change: C172*
SMART Domains Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

DomainStartEndE-ValueType
low complexity region 41 46 N/A INTRINSIC
low complexity region 61 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143578
SMART Domains Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

DomainStartEndE-ValueType
low complexity region 33 38 N/A INTRINSIC
low complexity region 53 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147006
Meta Mutation Damage Score 0.6404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mta1 T A 12: 113,133,525 probably null Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in 1700012B07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:1700012B07Rik APN 11 109794111 missense probably damaging 0.99
IGL03006:1700012B07Rik APN 11 109827845 missense probably damaging 0.98
R0626:1700012B07Rik UTSW 11 109788721 unclassified probably benign
R1566:1700012B07Rik UTSW 11 109788806 missense probably benign 0.01
R1654:1700012B07Rik UTSW 11 109797399 missense probably benign 0.36
R2373:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2405:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2410:1700012B07Rik UTSW 11 109794154 nonsense probably null
R2411:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3707:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3708:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3732:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3745:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3783:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3784:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3785:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3805:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3806:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3922:1700012B07Rik UTSW 11 109794154 nonsense probably null
R3926:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4085:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4089:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4110:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4111:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4112:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4171:1700012B07Rik UTSW 11 109794154 nonsense probably null
R4506:1700012B07Rik UTSW 11 109794261 missense probably damaging 1.00
R4825:1700012B07Rik UTSW 11 109791672 missense probably benign 0.00
R5033:1700012B07Rik UTSW 11 109794154 nonsense probably null
R5971:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6078:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6079:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6138:1700012B07Rik UTSW 11 109794154 nonsense probably null
R6354:1700012B07Rik UTSW 11 109794216 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCGGAGAATAGATGCTTGCC -3'
(R):5'- AGCTGCCTCCTGTAGAGTAC -3'

Sequencing Primer
(F):5'- GCTTGCCAATCTAAGATACTGAG -3'
(R):5'- GTACAGCTTGTCTAACGAAGC -3'
Posted On2016-06-06