Incidental Mutation 'R5032:Mta1'
ID391778
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission 042623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5032 (G1)
Quality Score158
Status Validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 113133525 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
Predicted Effect probably null
Transcript: ENSMUST00000009099
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069690
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109723
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109726
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109727
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Meta Mutation Damage Score 0.6452 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Actl9 A G 17: 33,434,088 N374S probably benign Het
Ahcyl2 T A 6: 29,768,556 probably benign Het
Arfgef2 T C 2: 166,878,544 M1501T probably benign Het
Asb17 A T 3: 153,844,538 D69V probably damaging Het
Atp13a5 T C 16: 29,263,450 Y877C probably damaging Het
Atrip T C 9: 109,065,203 Q64R probably benign Het
Auts2 A G 5: 131,476,891 probably benign Het
Cacna2d1 G T 5: 16,359,070 R893L probably damaging Het
Ccdc138 C T 10: 58,573,636 R596C probably damaging Het
Cd163 A G 6: 124,311,669 Y353C probably damaging Het
Cdon T C 9: 35,489,034 Y1015H probably damaging Het
Chsy3 T C 18: 59,179,471 Y339H probably damaging Het
Cspp1 T C 1: 10,066,519 W190R probably benign Het
Ddx1 A T 12: 13,223,992 I570N probably damaging Het
Duox1 G A 2: 122,337,317 R1027H probably benign Het
Dync1h1 C T 12: 110,626,892 Q1198* probably null Het
Ecel1 G A 1: 87,154,253 S246L probably damaging Het
Fam228b T G 12: 4,763,042 R109S probably damaging Het
Fut9 T A 4: 25,799,245 probably benign Het
Gm5346 T C 8: 43,626,471 N239D probably damaging Het
Gm5592 A G 7: 41,289,735 R814G probably damaging Het
Gmps A G 3: 63,990,325 K233E probably benign Het
Gramd1c A G 16: 43,990,663 Y438H probably damaging Het
Gsdmc A T 15: 63,802,033 D134E possibly damaging Het
Gxylt2 A G 6: 100,783,181 I226V probably benign Het
Hc T C 2: 35,013,532 I1037V probably benign Het
Hspa4 T G 11: 53,289,123 R69S possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Kifc3 A G 8: 95,102,726 S508P probably damaging Het
Krt7 G A 15: 101,412,547 R25H probably benign Het
Lhfp T A 3: 53,043,433 S43T possibly damaging Het
Lrrc7 T A 3: 158,181,580 K394N possibly damaging Het
Lypd4 A T 7: 24,866,815 L28Q probably damaging Het
Mdc1 A G 17: 35,850,589 E798G probably benign Het
Mtg2 A T 2: 180,083,390 Q132L possibly damaging Het
Myh1 G T 11: 67,206,048 E382* probably null Het
Myo3a T C 2: 22,282,602 L175P probably damaging Het
Nckap5 A T 1: 125,977,049 F144L possibly damaging Het
Nfrkb T A 9: 31,389,055 probably null Het
Nmt2 C T 2: 3,284,392 P5L probably benign Het
Nsmf T C 2: 25,055,061 probably null Het
Olfr635 A T 7: 103,979,374 M61L probably damaging Het
Olfr76 T A 19: 12,120,056 I219F probably benign Het
Oprl1 C T 2: 181,719,002 R257C probably damaging Het
Pcdhgc3 T A 18: 37,807,585 N346K probably damaging Het
Pcnt G A 10: 76,355,077 P2791S probably benign Het
Pdia3 A G 2: 121,414,139 N11S probably benign Het
Pik3c2g A T 6: 139,896,202 T778S probably benign Het
Pik3ip1 T A 11: 3,333,520 I75N probably damaging Het
Pla2g4d A T 2: 120,281,695 Y118* probably null Het
Ppargc1b A G 18: 61,307,265 S845P probably damaging Het
Prdm2 A T 4: 143,179,367 L50* probably null Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pxdn G A 12: 30,003,141 V926I probably benign Het
Rab11fip2 A T 19: 59,937,367 N139K probably damaging Het
Rcn2 T A 9: 56,053,016 M189K probably damaging Het
Rev1 A T 1: 38,074,489 probably benign Het
Rhbg C A 3: 88,245,134 G368C probably damaging Het
Rnf214 A G 9: 45,899,744 probably null Het
Sf3a3 T C 4: 124,725,166 S307P probably benign Het
Slc6a18 T A 13: 73,666,323 Y494F probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag16 T G 1: 69,853,352 N97K probably benign Het
Tmem192 T C 8: 64,959,511 V114A possibly damaging Het
Urb1 G T 16: 90,756,171 P1901T probably benign Het
Vwa5b2 A G 16: 20,600,709 T601A probably damaging Het
Wdtc1 G T 4: 133,308,851 T126K possibly damaging Het
Xirp2 T C 2: 67,525,670 Y3592H possibly damaging Het
Xylt2 A T 11: 94,670,016 V232E probably damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCTGAGCTTAAGGACTGGCC -3'
(R):5'- TCTACCAAGAGACAAGTCTACAGGG -3'

Sequencing Primer
(F):5'- CTTAAGGACTGGCCCTGTGAAG -3'
(R):5'- CAAGTCTACAGGGGCACG -3'
Posted On2016-06-06