Incidental Mutation 'IGL03048:Mamdc4'
ID391798
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #IGL03048 (G1)
Quality Score118
Status Validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25569072 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 229 (R229K)
Ref Sequence ENSEMBL: ENSMUSP00000109861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095117
AA Change: R233K

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: R233K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114223
AA Change: R229K

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: R229K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152124
Predicted Effect unknown
Transcript: ENSMUST00000152237
AA Change: R209K
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: R209K

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,978,699 probably null Het
Anapc4 C T 5: 52,839,733 T116I probably benign Het
Arhgap45 C T 10: 80,017,017 R14C probably damaging Het
BC055324 G A 1: 163,964,525 A608V probably benign Het
Bysl T C 17: 47,602,635 probably null Het
Ccdc166 T A 15: 75,982,201 N10I possibly damaging Het
Chd1l T C 3: 97,597,763 S163G probably benign Het
Col6a3 A G 1: 90,810,248 V576A possibly damaging Het
Cpped1 T C 16: 11,828,475 T162A probably benign Het
Dcbld1 A T 10: 52,304,626 I200F probably damaging Het
Dock6 T C 9: 21,809,570 E1713G probably damaging Het
Evx1 T C 6: 52,315,754 L130P probably benign Het
Fam168a A G 7: 100,835,338 T228A probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Foxp4 A T 17: 47,880,840 M124K unknown Het
Gabrr3 A G 16: 59,430,130 H164R probably benign Het
Gm3839 T A 14: 11,281,873 I21F probably benign Het
Gm8994 A T 6: 136,329,200 T220S probably damaging Het
Greb1 C T 12: 16,733,331 C134Y probably damaging Het
Hddc2 G A 10: 31,316,336 V79I possibly damaging Het
Lbr T C 1: 181,838,544 probably benign Het
Mtor T C 4: 148,546,390 probably benign Het
Ncoa1 T C 12: 4,267,922 R1137G probably damaging Het
Nlrp4d T C 7: 10,358,954 noncoding transcript Het
Oasl1 T A 5: 114,937,341 S487T possibly damaging Het
Olfr385 G C 11: 73,589,005 H244Q possibly damaging Het
Olfr736 G T 14: 50,392,788 V11L possibly damaging Het
Olfr952 A G 9: 39,426,769 F101L probably benign Het
Oprm1 T C 10: 6,829,064 I91T probably damaging Het
Pdzk1ip1 T A 4: 115,092,984 D147E probably benign Het
Per1 A G 11: 69,104,726 K711E probably damaging Het
Rab3gap1 A G 1: 127,937,477 N734S probably damaging Het
Rapgefl1 T C 11: 98,837,164 L4P possibly damaging Het
Sgk2 A G 2: 162,995,760 Y101C probably damaging Het
Tmem129 A G 5: 33,655,467 V179A possibly damaging Het
Ttn T C 2: 76,888,915 probably benign Het
Ttyh2 T A 11: 114,696,695 M174K probably benign Het
Vmn2r13 G A 5: 109,156,285 A760V probably damaging Het
Vmn2r82 A T 10: 79,396,626 I820F probably damaging Het
Zswim4 T C 8: 84,211,975 M1093V possibly damaging Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense not run
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTCAAGGTCTAGTCTCCCATGTTC -3'
(R):5'- TTTTCTGCCACCCGAAATGC -3'

Sequencing Primer
(F):5'- AGGTCTAGTCTCCCATGTTCATTCTG -3'
(R):5'- CGAAATGCCACACACAGGGG -3'
Posted On2016-06-07