Incidental Mutation 'R0441:Naip2'
ID39183
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene NameNLR family, apoptosis inhibitory protein 2
SynonymsBirc1b, Naip2, Naip-rs6
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0441 (G1)
Quality Score163
Status Validated
Chromosome13
Chromosomal Location100144063-100202092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 100161782 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 582 (I582S)
Ref Sequence ENSEMBL: ENSMUSP00000113890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
Predicted Effect probably benign
Transcript: ENSMUST00000067975
AA Change: I582S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: I582S

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117913
AA Change: I582S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: I582S

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167986
AA Change: I582S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: I582S

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACATACTGCTGCCACGAAGAGGG -3'
(R):5'- TTCCGCCACATGAACTTGCCAG -3'

Sequencing Primer
(F):5'- GGGAAACTCTTTGATCTCTAGACTCG -3'
(R):5'- GCGATGTGTCCATCATTTCAAAG -3'
Posted On2013-05-23