Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL03046:Kif1a'

391837

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene?

Probably essential (E-score: 0.877) question?

Stock #

IGL03046 (G1)

Quality Score

114

Status

Validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 93082406 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 6 (V6M)

Ref Sequence

ENSEMBL: ENSMUSP00000140163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000186861] [ENSMUST00000190723]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086819
AA Change: V6M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: V6M

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112958
AA Change: V6M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: V6M

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171556
AA Change: V6M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: V6M

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171796
AA Change: V6M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: V6M

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186861
AA Change: V6M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141194
Gene: ENSMUSG00000014602
AA Change: V6M

Domain	Start	End	E-Value	Type
KISc	3	109	9.7e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188493

Predicted Effect

probably damaging
Transcript: ENSMUST00000190723
AA Change: V6M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: V6M

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Meta Mutation Damage Score

0.452

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,150	L279Q	possibly damaging	Het
A2m	T	A	6: 121,659,323	M717K	probably benign	Het
Acad12	C	A	5: 121,609,966	V130L	probably benign	Het
Cdca2	T	C	14: 67,700,022		probably benign	Het
Cfap100	T	A	6: 90,412,350		probably null	Het
Cfap43	T	A	19: 47,815,863	E298V	probably damaging	Het
Cic	C	T	7: 25,291,075	P1971S	probably damaging	Het
Cnga1	T	C	5: 72,604,338	D611G	probably benign	Het
Daglb	C	T	5: 143,501,193	P522L	probably damaging	Het
Dclre1b	A	T	3: 103,803,281	I438K	probably benign	Het
Ddx5	C	A	11: 106,785,045	R273M	probably damaging	Het
Eepd1	C	T	9: 25,482,685	L82F	probably damaging	Het
Emilin3	G	A	2: 160,908,729	Q320*	probably null	Het
Exoc6	T	C	19: 37,593,769		probably null	Het
Fcna	G	C	2: 25,630,681		probably benign	Het
Foxs1	T	C	2: 152,932,564	T190A	probably benign	Het
Gje1	A	G	10: 14,716,630	L136P	probably damaging	Het
Hdac11	A	G	6: 91,168,845	T176A	probably benign	Het
Hhip	C	A	8: 79,972,338	V700L	probably damaging	Het
Hps5	T	C	7: 46,777,039		probably benign	Het
Itgb1bp1	T	C	12: 21,279,435	S13G	unknown	Het
Kcna1	A	T	6: 126,642,185	L391M	possibly damaging	Het
Klhl6	T	C	16: 19,982,889	I39V	probably benign	Het
Ltn1	A	T	16: 87,405,621	S1047R	probably benign	Het
Mdn1	A	G	4: 32,694,495	T1073A	possibly damaging	Het
Megf10	G	T	18: 57,287,983	A898S	possibly damaging	Het
Mtmr6	T	C	14: 60,292,128		probably null	Het
Mtnr1b	T	C	9: 15,862,763	I333M	probably benign	Het
Muc5ac	G	T	7: 141,795,213	C463F	probably benign	Het
Mycbpap	G	T	11: 94,505,717	T99N	possibly damaging	Het
Myo7a	C	T	7: 98,079,327	C824Y	probably damaging	Het
N4bp2	A	G	5: 65,790,960	H311R	probably damaging	Het
Nepro	T	A	16: 44,732,146		probably benign	Het
Nop56	A	T	2: 130,275,569		probably benign	Het
Nup210	A	G	6: 91,018,996		probably benign	Het
Olfr1426	A	G	19: 12,088,027	V255A	probably damaging	Het
Olfr843	T	A	9: 19,249,145	I85F	probably damaging	Het
Pcna	C	T	2: 132,251,753	E109K	probably benign	Het
Pkhd1	T	G	1: 20,537,365	D1089A	possibly damaging	Het
Plb1	A	G	5: 32,328,412	R847G	probably damaging	Het
Pou6f2	A	G	13: 18,129,027		probably benign	Het
Prss43	C	G	9: 110,830,981	S371C	probably benign	Het
Ralgapa1	A	T	12: 55,695,157	V1322D	probably damaging	Het
Rrp8	A	G	7: 105,734,902	V131A	probably benign	Het
Rtp1	A	T	16: 23,429,294	K39M	probably benign	Het
Slc1a6	A	G	10: 78,800,174	I358V	probably benign	Het
Slc25a15	T	C	8: 22,395,710		probably benign	Het
Slc43a1	G	A	2: 84,854,553		probably benign	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Spock3	T	G	8: 63,348,984		probably null	Het
Tbc1d7	T	C	13: 43,154,686		probably null	Het
Tmem184c	C	T	8: 77,599,657	W260*	probably null	Het
Tmem8	A	T	17: 26,119,440		probably null	Het
Trnau1ap	A	G	4: 132,311,941	Y265H	probably damaging	Het
Usp25	T	C	16: 77,074,866	F363S	probably damaging	Het
Vcl	T	C	14: 21,022,017	F817L	possibly damaging	Het
Vmn1r13	T	A	6: 57,210,732	M292K	probably benign	Het
Xpc	G	T	6: 91,510,481	A89E	probably damaging	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	unclassified	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- CCTAGACTAGGTTGGCTCTTGG -3'
(R):5'- ACACTCAGCTTAGATTTGTGCTG -3'

Sequencing Primer
(F):5'- CTCTTGGGTCTGGCTAGTAGGC -3'
(R):5'- AAATTAGTGCTTTTCTCACCTGTAGC -3'

Posted On

2016-06-07