Incidental Mutation 'IGL03046:N4bp2'
ID391849
Institutional Source Beutler Lab
Gene Symbol N4bp2
Ensembl Gene ENSMUSG00000037795
Gene NameNEDD4 binding protein 2
SynonymsB3bp, LOC333789, LOC386488
Accession Numbers

Genbank: NM_001024917.1; Ensembl: ENSMUST00000113738

Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #IGL03046 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65763521-65830108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65790960 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 311 (H311R)
Ref Sequence ENSEMBL: ENSMUSP00000143807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087264] [ENSMUST00000201489] [ENSMUST00000201615]
Predicted Effect probably damaging
Transcript: ENSMUST00000087264
AA Change: H311R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084519
Gene: ENSMUSG00000037795
AA Change: H311R

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.1e-15 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201489
AA Change: H311R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143807
Gene: ENSMUSG00000037795
AA Change: H311R

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 1e-9 BLAST
low complexity region 1496 1511 N/A INTRINSIC
DUF1771 1526 1591 1.88e-21 SMART
SMR 1596 1678 1.09e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201615
AA Change: H311R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144278
Gene: ENSMUSG00000037795
AA Change: H311R

DomainStartEndE-ValueType
low complexity region 109 130 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
Pfam:AAA_33 365 499 1.2e-14 PFAM
low complexity region 533 546 N/A INTRINSIC
low complexity region 619 629 N/A INTRINSIC
low complexity region 681 692 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
Blast:CUE 1430 1472 8e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202934
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a polynucleotide kinase domain (PNK) near the N-terminal region, and a Small MutS Related (Smr) domain near the C-terminal region. The encoded protein can bind to both B-cell leukemia/lymphoma 3 (BCL-3) and neural precursor cell expressed, developmentally downregulated 4, (Nedd4) proteins. This protein binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. This protein may play a role in transcription-coupled DNA repair or genetic recombination. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in N4bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:N4bp2 APN 5 65807524 missense probably damaging 0.96
IGL01503:N4bp2 APN 5 65803547 nonsense probably null 0.00
IGL01621:N4bp2 APN 5 65790924 missense probably damaging 1.00
IGL02109:N4bp2 APN 5 65798134 missense probably damaging 1.00
IGL02286:N4bp2 APN 5 65803552 missense probably damaging 1.00
1mM(1):N4bp2 UTSW 5 65807677 missense probably damaging 1.00
R0164:N4bp2 UTSW 5 65803573 splice site probably benign
R0285:N4bp2 UTSW 5 65806559 missense probably benign 0.00
R0366:N4bp2 UTSW 5 65806396 missense possibly damaging 0.95
R0548:N4bp2 UTSW 5 65808153 missense probably benign 0.39
R0551:N4bp2 UTSW 5 65820341 unclassified probably null
R0671:N4bp2 UTSW 5 65807437 missense probably damaging 0.99
R1136:N4bp2 UTSW 5 65808472 missense probably damaging 1.00
R1515:N4bp2 UTSW 5 65790498 missense probably benign 0.01
R1597:N4bp2 UTSW 5 65807140 missense probably benign 0.45
R1628:N4bp2 UTSW 5 65803572 splice site probably null
R1722:N4bp2 UTSW 5 65806882 missense probably benign 0.08
R1735:N4bp2 UTSW 5 65808316 missense probably damaging 1.00
R1745:N4bp2 UTSW 5 65790822 missense probably benign 0.12
R1759:N4bp2 UTSW 5 65826613 missense probably damaging 1.00
R1799:N4bp2 UTSW 5 65806825 missense possibly damaging 0.62
R1846:N4bp2 UTSW 5 65808519 missense probably damaging 1.00
R1872:N4bp2 UTSW 5 65794518 splice site probably benign
R2042:N4bp2 UTSW 5 65826621 missense probably damaging 1.00
R2082:N4bp2 UTSW 5 65807565 missense probably damaging 1.00
R2101:N4bp2 UTSW 5 65790881 missense probably damaging 1.00
R2147:N4bp2 UTSW 5 65809200 missense probably damaging 1.00
R2251:N4bp2 UTSW 5 65806728 missense probably damaging 1.00
R2507:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2508:N4bp2 UTSW 5 65790061 missense probably benign 0.01
R2919:N4bp2 UTSW 5 65807098 missense probably benign 0.22
R3086:N4bp2 UTSW 5 65791053 missense probably damaging 1.00
R4092:N4bp2 UTSW 5 65790456 missense probably benign 0.02
R4177:N4bp2 UTSW 5 65798170 splice site probably null
R4718:N4bp2 UTSW 5 65803463 missense probably damaging 1.00
R4859:N4bp2 UTSW 5 65825298 missense probably damaging 1.00
R4863:N4bp2 UTSW 5 65808130 missense probably benign 0.22
R4915:N4bp2 UTSW 5 65803504 missense probably damaging 1.00
R4949:N4bp2 UTSW 5 65821799 splice site probably null
R4978:N4bp2 UTSW 5 65790240 missense probably damaging 1.00
R5029:N4bp2 UTSW 5 65814780 missense probably damaging 1.00
R5079:N4bp2 UTSW 5 65811977 missense probably damaging 1.00
R5097:N4bp2 UTSW 5 65817218 missense probably damaging 1.00
R5158:N4bp2 UTSW 5 65808462 missense probably damaging 0.99
R5228:N4bp2 UTSW 5 65807518 missense probably benign
R5322:N4bp2 UTSW 5 65790457 missense possibly damaging 0.76
R5554:N4bp2 UTSW 5 65808114 missense probably benign 0.44
R5731:N4bp2 UTSW 5 65809157 missense probably damaging 1.00
R5840:N4bp2 UTSW 5 65808094 missense probably damaging 0.99
R6393:N4bp2 UTSW 5 65791001 missense possibly damaging 0.81
R6767:N4bp2 UTSW 5 65817187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAACTGCCACCAAAGG -3'
(R):5'- TCAATAAAACTTCCTACCTTGCCAG -3'

Sequencing Primer
(F):5'- GGGAAGGATATGAATTACTGCCC -3'
(R):5'- AGGATTTCCCTGAGCCCG -3'
Posted On2016-06-07