Incidental Mutation 'IGL03046:Rrp8'
ID391859
Institutional Source Beutler Lab
Gene Symbol Rrp8
Ensembl Gene ENSMUSG00000030888
Gene Nameribosomal RNA processing 8, methyltransferase, homolog (yeast)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #IGL03046 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105731730-105737385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105734902 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000095752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect probably benign
Transcript: ENSMUST00000033179
AA Change: V85A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888
AA Change: V85A

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098148
AA Change: V131A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888
AA Change: V131A

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127738
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137902
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148176
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154852
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Rrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rrp8 APN 7 105733016 unclassified probably benign
IGL02792:Rrp8 APN 7 105733811 nonsense probably null
IGL03010:Rrp8 APN 7 105734391 missense probably benign 0.01
IGL03404:Rrp8 APN 7 105734938 missense probably benign 0.41
R0682:Rrp8 UTSW 7 105734011 missense probably damaging 0.97
R2314:Rrp8 UTSW 7 105734804 missense probably benign 0.37
R4222:Rrp8 UTSW 7 105734022 missense possibly damaging 0.86
R4778:Rrp8 UTSW 7 105737274 intron probably benign
R4940:Rrp8 UTSW 7 105734077 nonsense probably null
R5315:Rrp8 UTSW 7 105734000 missense probably benign 0.00
R5480:Rrp8 UTSW 7 105734129 missense probably damaging 1.00
R5630:Rrp8 UTSW 7 105733401 missense possibly damaging 0.83
R6266:Rrp8 UTSW 7 105736389 missense probably damaging 1.00
R6351:Rrp8 UTSW 7 105734809 missense probably damaging 0.99
R6353:Rrp8 UTSW 7 105734118 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGGTCAACACTGTCCAGGG -3'
(R):5'- TAGCTGAAGCCCATCTCTCC -3'

Sequencing Primer
(F):5'- TGGGTTAGGTGTAAAGAGGAATATTC -3'
(R):5'- AGTCTCCAGGCCTCGTC -3'
Posted On2016-06-07