Incidental Mutation 'R0441:Lrch1'
ID39186
Institutional Source Beutler Lab
Gene Symbol Lrch1
Ensembl Gene ENSMUSG00000068015
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms4832412D13Rik, Chdc1
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0441 (G1)
Quality Score198
Status Validated
Chromosome14
Chromosomal Location74754675-74947876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74947545 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 39 (G39D)
Ref Sequence ENSEMBL: ENSMUSP00000154004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088970] [ENSMUST00000228252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088970
AA Change: G39D

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086363
Gene: ENSMUSG00000068015
AA Change: G39D

DomainStartEndE-ValueType
low complexity region 25 44 N/A INTRINSIC
LRR 109 131 1.86e1 SMART
LRR_TYP 132 155 3.39e-3 SMART
LRR 177 199 1.41e1 SMART
LRR 200 223 4.34e-1 SMART
LRR 245 268 1.66e1 SMART
low complexity region 306 322 N/A INTRINSIC
CH 591 698 1.71e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228252
AA Change: G39D

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a leucine-rich repeat and a calponin homology domain. Polymorphism in this gene may be associated with susceptibililty to knee osteoarthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous knockout leads to increased susceptibility to experimental autoimmune encephalomyelitis as a result of increased migration of T cells into the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in Lrch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Lrch1 APN 14 74757063 missense probably benign 0.22
IGL01137:Lrch1 APN 14 74757092 missense probably damaging 0.98
IGL01978:Lrch1 APN 14 74786342 missense probably damaging 1.00
IGL01988:Lrch1 APN 14 74795373 splice site probably benign
IGL02036:Lrch1 APN 14 74795293 splice site probably benign
IGL02650:Lrch1 APN 14 74813698 missense probably damaging 1.00
IGL03006:Lrch1 APN 14 74813620 missense probably damaging 0.99
IGL03106:Lrch1 APN 14 74835762 missense possibly damaging 0.84
IGL03353:Lrch1 APN 14 74858042 missense probably damaging 1.00
FR4304:Lrch1 UTSW 14 74819565 missense possibly damaging 0.81
LCD18:Lrch1 UTSW 14 74905021 intron probably benign
R0129:Lrch1 UTSW 14 74835746 missense probably benign 0.13
R0312:Lrch1 UTSW 14 74947594 missense possibly damaging 0.82
R0622:Lrch1 UTSW 14 74796051 missense probably benign 0.00
R1418:Lrch1 UTSW 14 74804269 splice site probably benign
R1618:Lrch1 UTSW 14 74813704 missense probably damaging 1.00
R2116:Lrch1 UTSW 14 74785531 missense probably damaging 1.00
R2428:Lrch1 UTSW 14 74807545 splice site probably benign
R3707:Lrch1 UTSW 14 74857997 missense probably damaging 0.99
R4352:Lrch1 UTSW 14 74818578 missense probably damaging 0.98
R5689:Lrch1 UTSW 14 74786324 missense probably damaging 1.00
R5754:Lrch1 UTSW 14 74817118 missense probably damaging 1.00
R6142:Lrch1 UTSW 14 74947500 missense probably damaging 1.00
R6469:Lrch1 UTSW 14 74817085 missense probably damaging 1.00
R6740:Lrch1 UTSW 14 74811623 missense probably benign
R6871:Lrch1 UTSW 14 74811623 missense probably benign
R7051:Lrch1 UTSW 14 74785522 missense probably damaging 1.00
R7438:Lrch1 UTSW 14 74757037 missense possibly damaging 0.88
R7509:Lrch1 UTSW 14 74947608 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCCGAGCCAATCTAGTAACACATTC -3'
(R):5'- TGTAAACTACAAGGGGTCGGGCTG -3'

Sequencing Primer
(F):5'- GGAAGGAGCGACAGCCC -3'
(R):5'- TGCATCCAGTTCCAGCCAG -3'
Posted On2013-05-23