Incidental Mutation 'IGL03046:Spock3'
ID391861
Institutional Source Beutler Lab
Gene Symbol Spock3
Ensembl Gene ENSMUSG00000054162
Gene Namesparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonymstestican 3, 2900045C01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL03046 (G1)
Quality Score145
Status Validated
Chromosome8
Chromosomal Location62951009-63357103 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 63348984 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093480] [ENSMUST00000117377] [ENSMUST00000118003] [ENSMUST00000119068]
Predicted Effect probably null
Transcript: ENSMUST00000093480
SMART Domains Protein: ENSMUSP00000091192
Gene: ENSMUSG00000054162

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117377
SMART Domains Protein: ENSMUSP00000113797
Gene: ENSMUSG00000054162

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 135 180 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 195 305 5e-35 PFAM
TY 335 381 2.27e-17 SMART
low complexity region 400 431 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118003
SMART Domains Protein: ENSMUSP00000113683
Gene: ENSMUSG00000054162

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 1.1e-36 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119068
SMART Domains Protein: ENSMUSP00000112930
Gene: ENSMUSG00000054162

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious morphological or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Spock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Spock3 APN 8 63348959 missense probably benign 0.01
IGL01716:Spock3 APN 8 63355350 missense unknown
IGL02058:Spock3 APN 8 63245198 nonsense probably null
IGL02450:Spock3 APN 8 63245215 critical splice donor site probably null
IGL02610:Spock3 APN 8 63345737 missense probably damaging 1.00
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0084:Spock3 UTSW 8 63143929 missense probably damaging 1.00
R1422:Spock3 UTSW 8 63143989 missense possibly damaging 0.89
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1484:Spock3 UTSW 8 63220705 missense probably damaging 1.00
R1728:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1729:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1739:Spock3 UTSW 8 63348947 missense probably damaging 0.99
R2057:Spock3 UTSW 8 63245170 nonsense probably null
R2340:Spock3 UTSW 8 63345713 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3733:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3763:Spock3 UTSW 8 63144015 critical splice donor site probably null
R5000:Spock3 UTSW 8 63245124 missense possibly damaging 0.86
R5069:Spock3 UTSW 8 63355265 missense probably benign 0.01
R5076:Spock3 UTSW 8 63345855 missense probably damaging 1.00
R5232:Spock3 UTSW 8 63345809 missense probably damaging 1.00
R5329:Spock3 UTSW 8 63345782 missense probably damaging 1.00
R5621:Spock3 UTSW 8 63144006 missense probably benign 0.19
R5882:Spock3 UTSW 8 63143931 missense probably benign 0.03
R5888:Spock3 UTSW 8 63355300 missense unknown
R5902:Spock3 UTSW 8 63355302 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCATGAGTCTTACGGTGATG -3'
(R):5'- ATGCCCAAATAGACACTTCTGC -3'

Sequencing Primer
(F):5'- GTGATGAAAATACTTGCTTGAGGC -3'
(R):5'- GCCCAAATAGACACTTCTGCTGATTC -3'
Posted On2016-06-07