Incidental Mutation 'IGL03046:Eepd1'
ID391866
Institutional Source Beutler Lab
Gene Symbol Eepd1
Ensembl Gene ENSMUSG00000036611
Gene Nameendonuclease/exonuclease/phosphatase family domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #IGL03046 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location25481547-25604110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25482685 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 82 (L82F)
Ref Sequence ENSEMBL: ENSMUSP00000047083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040677]
Predicted Effect probably damaging
Transcript: ENSMUST00000040677
AA Change: L82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047083
Gene: ENSMUSG00000036611
AA Change: L82F

DomainStartEndE-ValueType
HhH1 48 67 1.45e-1 SMART
HhH1 78 97 2.55e2 SMART
low complexity region 124 135 N/A INTRINSIC
HhH1 145 164 6.66e-1 SMART
Pfam:Exo_endo_phos 264 535 6.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156237
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Eepd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Eepd1 APN 9 25482482 missense probably damaging 1.00
IGL02110:Eepd1 APN 9 25603402 splice site probably benign
IGL02113:Eepd1 APN 9 25482713 missense probably damaging 1.00
IGL02188:Eepd1 APN 9 25581892 missense probably benign 0.01
IGL02930:Eepd1 APN 9 25483240 missense probably damaging 0.96
IGL03293:Eepd1 APN 9 25603412 missense possibly damaging 0.90
R0970:Eepd1 UTSW 9 25603426 missense probably damaging 1.00
R1037:Eepd1 UTSW 9 25586783 missense possibly damaging 0.94
R1441:Eepd1 UTSW 9 25483203 missense probably benign
R1835:Eepd1 UTSW 9 25482868 missense possibly damaging 0.84
R3912:Eepd1 UTSW 9 25483304 missense probably damaging 1.00
R4245:Eepd1 UTSW 9 25594624 missense probably benign 0.00
R4704:Eepd1 UTSW 9 25482826 missense probably benign
R4838:Eepd1 UTSW 9 25589460 missense possibly damaging 0.56
R5153:Eepd1 UTSW 9 25586753 missense probably benign 0.37
R5634:Eepd1 UTSW 9 25603553 missense probably benign 0.12
R5994:Eepd1 UTSW 9 25603453 missense probably damaging 1.00
R6141:Eepd1 UTSW 9 25482984 missense probably benign 0.00
R6709:Eepd1 UTSW 9 25482868 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATCGCTCTATCCCCAGAGATCC -3'
(R):5'- TCATGAGCTGAGCAAGGGTG -3'

Sequencing Primer
(F):5'- TGTCACATAACCGCAAGTTCAG -3'
(R):5'- GCTGTGTTGATATTGACTCGAGGAG -3'
Posted On2016-06-07