Incidental Mutation 'IGL03046:Slc1a6'
ID391869
Institutional Source Beutler Lab
Gene Symbol Slc1a6
Ensembl Gene ENSMUSG00000005357
Gene Namesolute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
SynonymsEAAT4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #IGL03046 (G1)
Quality Score117
Status Validated
Chromosome10
Chromosomal Location78780496-78814765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78800174 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 358 (I358V)
Ref Sequence ENSEMBL: ENSMUSP00000005490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005490]
Predicted Effect probably benign
Transcript: ENSMUST00000005490
AA Change: I358V

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005490
Gene: ENSMUSG00000005357
AA Change: I358V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:SDF 55 519 8.5e-129 PFAM
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene survive well and display no obvious abnormalities of behavior or brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Slc1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc1a6 APN 10 78801813 missense probably damaging 1.00
IGL00496:Slc1a6 APN 10 78793308 missense probably damaging 1.00
IGL01099:Slc1a6 APN 10 78788997 missense possibly damaging 0.67
IGL02299:Slc1a6 APN 10 78793303 missense probably damaging 1.00
IGL02677:Slc1a6 APN 10 78789064 missense probably damaging 1.00
IGL02705:Slc1a6 APN 10 78801954 missense probably damaging 1.00
IGL03024:Slc1a6 APN 10 78814608 missense probably benign
IGL03185:Slc1a6 APN 10 78801907 missense probably damaging 1.00
R0183:Slc1a6 UTSW 10 78791233 missense probably damaging 1.00
R0373:Slc1a6 UTSW 10 78801922 nonsense probably null
R0730:Slc1a6 UTSW 10 78796008 missense probably benign 0.13
R0774:Slc1a6 UTSW 10 78812824 missense probably benign 0.03
R0838:Slc1a6 UTSW 10 78796222 missense probably damaging 1.00
R1449:Slc1a6 UTSW 10 78800117 missense probably damaging 0.99
R1822:Slc1a6 UTSW 10 78812931 nonsense probably null
R1853:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1854:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1855:Slc1a6 UTSW 10 78812924 missense probably damaging 0.97
R1866:Slc1a6 UTSW 10 78791349 missense probably damaging 0.99
R2073:Slc1a6 UTSW 10 78800130 missense possibly damaging 0.93
R2279:Slc1a6 UTSW 10 78789048 missense probably benign 0.12
R2360:Slc1a6 UTSW 10 78812884 missense possibly damaging 0.91
R2939:Slc1a6 UTSW 10 78814614 makesense probably null
R3111:Slc1a6 UTSW 10 78789081 missense probably damaging 0.99
R3926:Slc1a6 UTSW 10 78812881 missense possibly damaging 0.91
R4116:Slc1a6 UTSW 10 78787889 missense probably benign 0.00
R4798:Slc1a6 UTSW 10 78800118 missense probably damaging 1.00
R4916:Slc1a6 UTSW 10 78796251 missense probably damaging 1.00
R5054:Slc1a6 UTSW 10 78814602 missense probably damaging 1.00
R5166:Slc1a6 UTSW 10 78796269 critical splice donor site probably null
R5304:Slc1a6 UTSW 10 78793307 missense probably damaging 1.00
R5367:Slc1a6 UTSW 10 78787803 missense probably damaging 1.00
R5554:Slc1a6 UTSW 10 78795982 missense probably benign 0.00
R5635:Slc1a6 UTSW 10 78789091 missense possibly damaging 0.67
R5773:Slc1a6 UTSW 10 78793277 splice site probably null
R6117:Slc1a6 UTSW 10 78788988 missense possibly damaging 0.72
R6167:Slc1a6 UTSW 10 78801837 missense probably benign 0.40
R6174:Slc1a6 UTSW 10 78801907 missense probably damaging 1.00
R6221:Slc1a6 UTSW 10 78800076 missense probably damaging 0.98
R6323:Slc1a6 UTSW 10 78812887 missense probably damaging 1.00
R6339:Slc1a6 UTSW 10 78800085 missense possibly damaging 0.94
R6670:Slc1a6 UTSW 10 78787812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCTTAGGAATGCCAGCCC -3'
(R):5'- CAACCAGAAGAGGTGTTTGGGC -3'

Sequencing Primer
(F):5'- GTCTTAGGAATGCCAGCCCTAGAC -3'
(R):5'- TGTTTGGGCAGGTAGAAAGG -3'
Posted On2016-06-07