Incidental Mutation 'IGL03046:0610010F05Rik'
List |< first << previous [record 28 of 386652] next >> last >|
ID391870
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Stock #IGL03046 (G1)
Quality Score65
Status Validated
Chromosome11
Chromosomal Location23564961-23633631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23615150 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 279 (L279Q)
Ref Sequence ENSEMBL: ENSMUSP00000121553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000109532] [ENSMUST00000141353] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043356
AA Change: L279Q

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: L279Q

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109532
AA Change: L279Q

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: L279Q

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141353
AA Change: L133Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121553
Gene: ENSMUSG00000042208
AA Change: L133Q

DomainStartEndE-ValueType
Pfam:DUF3342 1 189 7.1e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155903
AA Change: L279Q

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: L279Q

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180260
AA Change: L279Q

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: L279Q

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
BC027231 T A 16: 44,732,146 F587Y noncoding transcript Het
Ccdc37 T A 6: 90,412,350 Het
Cdca2 T C 14: 67,700,022 I445V noncoding transcript Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcnaos G C 2: 25,630,681 M354I noncoding transcript Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Lpcat4 C A 2: 112,241,989 F6L probably null Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S probably benign Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T617N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nup210 A G 6: 91,018,996 Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 C468R not run Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 Het
Slc43a1 G A 2: 84,854,553 Het
Snord110 A T 2: 130,275,569 S22C noncoding transcript Het
Speer4cos A C 5: 15,714,216 S235R noncoding transcript Homo
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 Y492F possibly damaging Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M⇒K probably benign Het
Xpc G T 6: 91,510,481 A91E possibly damaging Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice donor site probably benign 0.00
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null
IGL01819:0610010F05Rik APN 11 23584561 missense probably damaging 1.00
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 1.00
R0139:0610010F05Rik UTSW 11 23620214 splice donor site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice donor site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense possibly damaging 0.64
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1353:0610010F05Rik UTSW 11 23620217 splice donor site probably benign
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 1.00
R1568:0610010F05Rik UTSW 11 23589971 missense possibly damaging 0.90
R2163:0610010F05Rik UTSW 11 23576826 splice acceptor site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 unclassified probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5046:0610010F05Rik UTSW 11 23620354 missense probably benign 0.23
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACGTCTTAATCTTAACACAGCTC -3'
(R):5'- TGGAAGGTATTACTCTGTCGATATC -3'

Sequencing Primer
(F):5'- GTAAGTGGTTTCCTGACATCCACATG -3'
(R):5'- ATGAATGCCATAGTAGCTG -3'
Posted OnJun 07, 2016