Incidental Mutation 'IGL03046:Itgb1bp1'
ID391873
Institutional Source Beutler Lab
Gene Symbol Itgb1bp1
Ensembl Gene ENSMUSG00000062352
Gene Nameintegrin beta 1 binding protein 1
Synonymsbodenin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03046 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location21240825-21286284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21279435 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 13 (S13G)
Ref Sequence ENSEMBL: ENSMUSP00000156312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076260] [ENSMUST00000172834] [ENSMUST00000173729] [ENSMUST00000232072]
Predicted Effect unknown
Transcript: ENSMUST00000076260
AA Change: S13G
SMART Domains Protein: ENSMUSP00000075609
Gene: ENSMUSG00000062352
AA Change: S13G

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
PTB 58 200 1.42e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172834
AA Change: S13G
SMART Domains Protein: ENSMUSP00000134508
Gene: ENSMUSG00000062352
AA Change: S13G

DomainStartEndE-ValueType
Pfam:ICAP-1_inte_bdg 1 183 5.1e-115 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173729
AA Change: S13G
SMART Domains Protein: ENSMUSP00000134627
Gene: ENSMUSG00000062352
AA Change: S13G

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
PTB 58 200 1.42e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000232072
AA Change: S13G
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, reduced weight and length, reduced ossification, and skull and skeleton abnormalities. Mice homozygous for a gene trap mutation are viable and do not exhibit any obvious abnormalites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Itgb1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Itgb1bp1 APN 12 21279468 missense unknown
IGL02812:Itgb1bp1 APN 12 21270878 splice site probably benign
IGL02820:Itgb1bp1 APN 12 21276853 missense possibly damaging 0.94
R0491:Itgb1bp1 UTSW 12 21276895 unclassified probably benign
R0511:Itgb1bp1 UTSW 12 21271435 missense probably damaging 1.00
R2158:Itgb1bp1 UTSW 12 21276859 missense probably damaging 1.00
R4476:Itgb1bp1 UTSW 12 21270956 missense probably benign 0.01
R4596:Itgb1bp1 UTSW 12 21272134 missense probably damaging 1.00
R4991:Itgb1bp1 UTSW 12 21274848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGAGTGGTTAAGTAGTGC -3'
(R):5'- GGAACACACCCACAGATGTG -3'

Sequencing Primer
(F):5'- TGCAAAAACAGGCATTATAGGC -3'
(R):5'- TGGAACTCACTAAGATCTGCCTG -3'
Posted On2016-06-07