Incidental Mutation 'IGL03046:Vcl'
ID391876
Institutional Source Beutler Lab
Gene Symbol Vcl
Ensembl Gene ENSMUSG00000021823
Gene Namevinculin
Synonymsmetavinculin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03046 (G1)
Quality Score74
Status Validated
Chromosome14
Chromosomal Location20929398-21033676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21022017 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 817 (F817L)
Ref Sequence ENSEMBL: ENSMUSP00000022369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022369
AA Change: F817L

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823
AA Change: F817L

DomainStartEndE-ValueType
Pfam:Vinculin 3 485 9e-203 PFAM
Pfam:Vinculin 475 1066 1.7e-301 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000224380
AA Change: F5L
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane. Defects in VCL are the cause of cardiomyopathy dilated type 1W. Dilated cardiomyopathy is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 10 with failed midline fusion of the rostral neural tube, bilobular cranial development and compromised cranial and spinal nerve development. Abnormal myocardial and endocardial structures are seen in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr1426 A G 19: 12,088,027 V255A probably damaging Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Vcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vcl APN 14 20987003 missense probably benign 0.00
IGL01755:Vcl APN 14 20995970 missense probably damaging 0.99
IGL01994:Vcl APN 14 21003243 missense probably damaging 1.00
IGL02128:Vcl APN 14 21020577 missense probably benign
IGL02168:Vcl APN 14 21007287 missense probably benign 0.21
IGL02502:Vcl APN 14 21019385 missense probably damaging 1.00
IGL02574:Vcl APN 14 20929575 nonsense probably null
IGL03103:Vcl APN 14 21024280 missense probably damaging 1.00
R0137:Vcl UTSW 14 20987015 nonsense probably null
R0320:Vcl UTSW 14 20985624 splice site probably benign
R1442:Vcl UTSW 14 20983378 missense probably damaging 1.00
R1546:Vcl UTSW 14 21008950 missense probably damaging 1.00
R1692:Vcl UTSW 14 21024182 missense probably damaging 0.99
R1709:Vcl UTSW 14 21019373 missense probably benign 0.03
R1737:Vcl UTSW 14 21020536 missense probably damaging 1.00
R1848:Vcl UTSW 14 21008995 missense probably benign 0.03
R1902:Vcl UTSW 14 20982699 missense probably damaging 1.00
R4623:Vcl UTSW 14 21014939 missense probably benign 0.33
R4654:Vcl UTSW 14 20985752 splice site probably null
R5084:Vcl UTSW 14 21008959 missense possibly damaging 0.54
R5168:Vcl UTSW 14 21010102 missense probably damaging 1.00
R5275:Vcl UTSW 14 21010078 missense probably damaging 1.00
R6637:Vcl UTSW 14 21003132 missense probably damaging 1.00
R6859:Vcl UTSW 14 20987075 missense probably damaging 1.00
X0028:Vcl UTSW 14 20985662 nonsense probably null
X0060:Vcl UTSW 14 21020776 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATCCTGTGACACTTCCTCAGG -3'
(R):5'- CTACAGAAGCCACCTGGAAATG -3'

Sequencing Primer
(F):5'- AGGGCCTCTGACTTGTCC -3'
(R):5'- CCACCTGGAAATGGAGACTG -3'
Posted On2016-06-07