Incidental Mutation 'IGL03046:Olfr1426'
ID391886
Institutional Source Beutler Lab
Gene Symbol Olfr1426
Ensembl Gene ENSMUSG00000044994
Gene Nameolfactory receptor 1426
SynonymsGA_x6K02T2RE5P-2447610-2446675, MOR239-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #IGL03046 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12086746-12092013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12088027 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000151988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112952] [ENSMUST00000208703] [ENSMUST00000217952] [ENSMUST00000219005] [ENSMUST00000219155] [ENSMUST00000219996] [ENSMUST00000220005]
Predicted Effect probably damaging
Transcript: ENSMUST00000112952
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108575
Gene: ENSMUSG00000044994
AA Change: V255A

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 2.1e-49 PFAM
Pfam:7tm_1 39 300 1.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208703
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217952
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219005
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219155
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219996
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000220005
AA Change: V255A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,150 L279Q possibly damaging Het
A2m T A 6: 121,659,323 M717K probably benign Het
Acad12 C A 5: 121,609,966 V130L probably benign Het
Cdca2 T C 14: 67,700,022 probably benign Het
Cfap100 T A 6: 90,412,350 probably null Het
Cfap43 T A 19: 47,815,863 E298V probably damaging Het
Cic C T 7: 25,291,075 P1971S probably damaging Het
Cnga1 T C 5: 72,604,338 D611G probably benign Het
Daglb C T 5: 143,501,193 P522L probably damaging Het
Dclre1b A T 3: 103,803,281 I438K probably benign Het
Ddx5 C A 11: 106,785,045 R273M probably damaging Het
Eepd1 C T 9: 25,482,685 L82F probably damaging Het
Emilin3 G A 2: 160,908,729 Q320* probably null Het
Exoc6 T C 19: 37,593,769 probably null Het
Fcna G C 2: 25,630,681 probably benign Het
Foxs1 T C 2: 152,932,564 T190A probably benign Het
Gje1 A G 10: 14,716,630 L136P probably damaging Het
Hdac11 A G 6: 91,168,845 T176A probably benign Het
Hhip C A 8: 79,972,338 V700L probably damaging Het
Hps5 T C 7: 46,777,039 probably benign Het
Itgb1bp1 T C 12: 21,279,435 S13G unknown Het
Kcna1 A T 6: 126,642,185 L391M possibly damaging Het
Kif1a C T 1: 93,082,406 V6M probably damaging Het
Klhl6 T C 16: 19,982,889 I39V probably benign Het
Ltn1 A T 16: 87,405,621 S1047R probably benign Het
Mdn1 A G 4: 32,694,495 T1073A possibly damaging Het
Megf10 G T 18: 57,287,983 A898S possibly damaging Het
Mtmr6 T C 14: 60,292,128 probably null Het
Mtnr1b T C 9: 15,862,763 I333M probably benign Het
Muc5ac G T 7: 141,795,213 C463F probably benign Het
Mycbpap G T 11: 94,505,717 T99N possibly damaging Het
Myo7a C T 7: 98,079,327 C824Y probably damaging Het
N4bp2 A G 5: 65,790,960 H311R probably damaging Het
Nepro T A 16: 44,732,146 probably benign Het
Nop56 A T 2: 130,275,569 probably benign Het
Nup210 A G 6: 91,018,996 probably benign Het
Olfr843 T A 9: 19,249,145 I85F probably damaging Het
Pcna C T 2: 132,251,753 E109K probably benign Het
Pkhd1 T G 1: 20,537,365 D1089A possibly damaging Het
Plb1 A G 5: 32,328,412 R847G probably damaging Het
Pou6f2 A G 13: 18,129,027 probably benign Het
Prss43 C G 9: 110,830,981 S371C probably benign Het
Ralgapa1 A T 12: 55,695,157 V1322D probably damaging Het
Rrp8 A G 7: 105,734,902 V131A probably benign Het
Rtp1 A T 16: 23,429,294 K39M probably benign Het
Slc1a6 A G 10: 78,800,174 I358V probably benign Het
Slc25a15 T C 8: 22,395,710 probably benign Het
Slc43a1 G A 2: 84,854,553 probably benign Het
Speer4c A C 5: 15,714,216 probably benign Het
Spock3 T G 8: 63,348,984 probably null Het
Tbc1d7 T C 13: 43,154,686 probably null Het
Tmem184c C T 8: 77,599,657 W260* probably null Het
Tmem8 A T 17: 26,119,440 probably null Het
Trnau1ap A G 4: 132,311,941 Y265H probably damaging Het
Usp25 T C 16: 77,074,866 F363S probably damaging Het
Vcl T C 14: 21,022,017 F817L possibly damaging Het
Vmn1r13 T A 6: 57,210,732 M292K probably benign Het
Xpc G T 6: 91,510,481 A89E probably damaging Het
Other mutations in Olfr1426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr1426 APN 19 12087993 missense probably benign 0.28
IGL01549:Olfr1426 APN 19 12087965 missense probably benign 0.20
IGL02479:Olfr1426 APN 19 12087905 missense probably benign 0.01
IGL03065:Olfr1426 APN 19 12088611 missense possibly damaging 0.91
IGL03092:Olfr1426 APN 19 12087866 nonsense probably null
R0734:Olfr1426 UTSW 19 12088119 missense probably benign 0.12
R1190:Olfr1426 UTSW 19 12088687 missense possibly damaging 0.82
R1990:Olfr1426 UTSW 19 12088256 missense probably damaging 0.98
R2331:Olfr1426 UTSW 19 12088158 missense probably benign 0.00
R3500:Olfr1426 UTSW 19 12088057 missense possibly damaging 0.58
R3768:Olfr1426 UTSW 19 12087940 missense probably damaging 1.00
R3825:Olfr1426 UTSW 19 12088027 missense probably damaging 0.98
R4589:Olfr1426 UTSW 19 12087941 missense possibly damaging 0.61
R5175:Olfr1426 UTSW 19 12088562 missense probably damaging 1.00
R6436:Olfr1426 UTSW 19 12087935 missense probably benign 0.24
R6729:Olfr1426 UTSW 19 12088496 missense probably benign 0.04
R6965:Olfr1426 UTSW 19 12088756 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AATGTTGTGACAGGGTCGAGC -3'
(R):5'- TGCCTGCACAGACATCTTTG -3'

Sequencing Primer
(F):5'- GACAGGGTCGAGCTATTGC -3'
(R):5'- GCACAGACATCTTTGTTCTTGAG -3'
Posted On2016-06-07