Incidental Mutation 'IGL02837:Adamts13'
ID391893
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #IGL02837 (G1)
Quality Score111
Status Validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26991420 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 803 (N803S)
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]
Predicted Effect probably benign
Transcript: ENSMUST00000014996
AA Change: N803S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: N803S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 2.3e-11 PFAM
Pfam:Reprolysin 84 291 1e-15 PFAM
Pfam:Reprolysin_3 113 237 2e-10 PFAM
Pfam:Reprolysin_2 132 281 5e-9 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102891
AA Change: N803S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: N803S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K82* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I55V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Kit G A 5: 75,639,008 V467I probably benign Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Ntsr2 G A 12: 16,653,875 V126M probably damaging Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Pik3c2g T A 6: 139,626,564 C249* probably null Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prl8a1 A G 13: 27,575,634 L140P probably damaging Het
Prpf6 C A 2: 181,622,263 D239E probably damaging Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Trim45 C T 3: 100,931,627 probably benign Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCCAACTGAAACCCTGG -3'
(R):5'- AACCCAGCACCTCTTGAATAGTG -3'

Sequencing Primer
(F):5'- TGAAACCCTGGCCCCAG -3'
(R):5'- GCACCTCTTGAATAGTGAGAAGGTTC -3'
Posted On2016-06-08