Incidental Mutation 'IGL02837:Prpf6'
ID391896
Institutional Source Beutler Lab
Gene Symbol Prpf6
Ensembl Gene ENSMUSG00000002455
Gene Namepre-mRNA splicing factor 6
SynonymsANT-1, U5-102K, 2610031L17Rik, 1190003A07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL02837 (G1)
Quality Score162
Status Validated
Chromosome2
Chromosomal Location181591868-181655660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 181622263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 239 (D239E)
Ref Sequence ENSEMBL: ENSMUSP00000121340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002529] [ENSMUST00000136481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002529
AA Change: D239E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002529
Gene: ENSMUSG00000002455
AA Change: D239E

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 2.5e-52 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136481
AA Change: D239E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121340
Gene: ENSMUSG00000002455
AA Change: D239E

DomainStartEndE-ValueType
Pfam:PRP1_N 13 169 1.3e-62 PFAM
low complexity region 220 236 N/A INTRINSIC
HAT 289 321 1.83e-1 SMART
HAT 323 355 2.83e1 SMART
HAT 384 416 1.08e-3 SMART
HAT 417 446 1.61e1 SMART
HAT 447 476 6.92e-2 SMART
HAT 554 586 2.2e-4 SMART
HAT 588 620 1.69e2 SMART
HAT 622 654 1.38e-1 SMART
HAT 656 687 3.41e1 SMART
HAT 689 721 3.99e1 SMART
HAT 723 755 3.38e-5 SMART
HAT 757 789 2.48e-3 SMART
HAT 791 823 5.64e1 SMART
Blast:TPR 841 874 2e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139955
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,957,581 V786I probably benign Het
Adamts13 A G 2: 26,991,420 N803S probably benign Het
Ago4 C G 4: 126,497,300 G730R possibly damaging Het
Amn T A 12: 111,271,899 M55K possibly damaging Het
Apob A T 12: 8,005,102 Y1334F probably damaging Het
Arl14ep A C 2: 106,969,229 L89R probably damaging Het
Bcam T G 7: 19,764,186 E304A probably damaging Het
Car10 A T 11: 93,597,251 Y258F probably damaging Het
Cerk T A 15: 86,144,695 K82* probably null Het
Chac2 T C 11: 30,977,496 N141S probably damaging Het
Clpx T G 9: 65,324,259 L556R probably damaging Het
Csgalnact2 T C 6: 118,124,403 I55V probably benign Het
Cul1 T C 6: 47,523,205 V650A probably benign Het
Dnah5 A T 15: 28,269,400 E895D probably benign Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Dpys A G 15: 39,857,305 S20P probably damaging Het
Fat1 G A 8: 45,017,434 V1490I probably benign Het
Flg2 T G 3: 93,201,737 C357W probably damaging Het
Flt1 T A 5: 147,655,170 D494V probably benign Het
Fpr-rs4 T A 17: 18,022,251 D173E probably benign Het
Gm2666 G T 1: 85,485,103 noncoding transcript Het
Gm3867 C A 9: 36,257,800 noncoding transcript Het
Gm5436 A T 12: 84,258,600 noncoding transcript Het
Kit G A 5: 75,639,008 V467I probably benign Het
Krtap4-16 A G 11: 99,851,037 V179A unknown Het
Lrp8 C A 4: 107,861,281 H693Q probably benign Het
Lrrc49 A G 9: 60,610,322 S75P probably benign Het
Ltbp4 C A 7: 27,314,381 V1068L probably damaging Het
Magel2 C T 7: 62,378,260 P304L possibly damaging Het
Muc19 T A 15: 91,882,656 noncoding transcript Het
Npas3 T C 12: 53,947,197 V175A possibly damaging Het
Nr1h4 A T 10: 89,516,480 H8Q probably benign Het
Ntsr2 G A 12: 16,653,875 V126M probably damaging Het
Odf2 A T 2: 29,926,713 T725S probably damaging Het
Olfr12 T C 1: 92,620,682 Y259H possibly damaging Het
Olfr183 C T 16: 59,000,546 P287L probably damaging Het
Olfr603 C T 7: 103,383,615 C129Y probably damaging Het
Pgr T C 9: 8,946,638 probably benign Het
Pik3c2g T A 6: 139,626,564 C249* probably null Het
Plcd3 C T 11: 103,071,103 V726M possibly damaging Het
Prl8a1 A G 13: 27,575,634 L140P probably damaging Het
Rcc1 C T 4: 132,337,756 R139H probably benign Het
Rimbp2 G T 5: 128,797,745 Q268K probably damaging Het
Rps19-ps13 A T 18: 40,726,394 noncoding transcript Het
Sema4c C A 1: 36,552,884 G266V probably damaging Het
Sema4g T C 19: 44,996,711 F156S probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Speer4f1 G T 5: 17,480,383 L225F unknown Het
Thrap3 T C 4: 126,165,364 probably benign Het
Tnfrsf8 T C 4: 145,268,998 E497G probably benign Het
Trim3 T C 7: 105,612,656 N631S probably damaging Het
Trim45 C T 3: 100,931,627 probably benign Het
Wdr43 A G 17: 71,642,736 D445G probably benign Het
Other mutations in Prpf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Prpf6 APN 2 181631511 missense probably benign
IGL01729:Prpf6 APN 2 181654917 missense probably damaging 1.00
IGL02077:Prpf6 APN 2 181640664 missense probably damaging 1.00
IGL02187:Prpf6 APN 2 181616016 missense probably damaging 1.00
IGL02452:Prpf6 APN 2 181649085 missense probably benign 0.00
IGL02881:Prpf6 APN 2 181632071 missense probably benign 0.21
IGL03220:Prpf6 APN 2 181632879 missense probably damaging 1.00
R0069:Prpf6 UTSW 2 181615963 splice site probably null
R0189:Prpf6 UTSW 2 181655457 missense probably benign 0.00
R0479:Prpf6 UTSW 2 181651127 missense probably benign 0.18
R0532:Prpf6 UTSW 2 181622211 missense possibly damaging 0.71
R0628:Prpf6 UTSW 2 181636048 missense probably damaging 0.96
R0674:Prpf6 UTSW 2 181631974 missense probably benign 0.05
R1863:Prpf6 UTSW 2 181608174 missense possibly damaging 0.81
R1954:Prpf6 UTSW 2 181632077 missense probably benign
R1955:Prpf6 UTSW 2 181632077 missense probably benign
R4612:Prpf6 UTSW 2 181632079 missense possibly damaging 0.81
R4627:Prpf6 UTSW 2 181601474 missense probably damaging 0.96
R5033:Prpf6 UTSW 2 181650106 missense possibly damaging 0.69
R5053:Prpf6 UTSW 2 181649453 missense probably benign 0.00
R5121:Prpf6 UTSW 2 181636043 missense probably benign
R5181:Prpf6 UTSW 2 181649546 missense probably damaging 0.98
R5380:Prpf6 UTSW 2 181608266 missense probably damaging 1.00
R5490:Prpf6 UTSW 2 181608165 missense probably benign 0.01
R5638:Prpf6 UTSW 2 181645588 missense probably benign 0.32
R5680:Prpf6 UTSW 2 181649140 missense probably damaging 0.99
R6152:Prpf6 UTSW 2 181621787 missense probably damaging 1.00
R6252:Prpf6 UTSW 2 181647363 missense probably damaging 1.00
R6317:Prpf6 UTSW 2 181631436 missense probably benign 0.06
R6501:Prpf6 UTSW 2 181621920 nonsense probably null
R6789:Prpf6 UTSW 2 181616051 nonsense probably null
R7023:Prpf6 UTSW 2 181620640 missense probably damaging 1.00
R7043:Prpf6 UTSW 2 181649504 missense probably benign
R7214:Prpf6 UTSW 2 181640596 missense probably damaging 1.00
R7538:Prpf6 UTSW 2 181652455 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGTAGCCATGCCTCATTAGG -3'
(R):5'- CCTACTCTATGACAGGGCAGAG -3'

Sequencing Primer
(F):5'- CTCATTAGGACATAGAGACGAGGTG -3'
(R):5'- TGACAGGGCAGAGTATCAATTTC -3'
Posted On2016-06-08