Incidental Mutation 'R0441:St3gal6'
ID39190
Institutional Source Beutler Lab
Gene Symbol St3gal6
Ensembl Gene ENSMUSG00000022747
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms1700023B24Rik, ST3Gal VI, Siat10
MMRRC Submission 038642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R0441 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58468125-58524243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58473453 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 238 (A238S)
Ref Sequence ENSEMBL: ENSMUSP00000115756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663] [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000137035]
Predicted Effect probably benign
Transcript: ENSMUST00000046663
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114357
AA Change: A238S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747
AA Change: A238S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114358
AA Change: A238S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747
AA Change: A238S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137035
AA Change: A238S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747
AA Change: A238S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149197
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit modest impairment in leukocyte rolling and neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,492 probably benign Het
Adgrv1 G A 13: 81,397,226 R5647* probably null Het
Agbl2 C T 2: 90,797,483 R211* probably null Het
Akap9 A G 5: 3,961,714 K806E probably benign Het
Ampd1 C G 3: 103,088,478 L235V probably benign Het
Atcay T C 10: 81,224,460 D14G possibly damaging Het
Atp8b4 C T 2: 126,378,706 probably benign Het
Bmp8b T C 4: 123,124,515 V393A probably damaging Het
Brca2 T A 5: 150,541,857 D1695E probably damaging Het
Cdh15 A G 8: 122,860,966 I210V probably damaging Het
Cep250 T C 2: 155,972,004 L564P possibly damaging Het
Cmpk1 T C 4: 114,965,023 T110A probably benign Het
Cpsf3 T G 12: 21,300,084 I268S probably damaging Het
Csmd2 C T 4: 128,520,230 A2621V probably benign Het
Cyp2c40 T C 19: 39,807,163 probably benign Het
D430041D05Rik T A 2: 104,167,947 Y1837F probably damaging Het
Degs2 A G 12: 108,702,214 F10S probably damaging Het
Dytn T A 1: 63,678,774 probably benign Het
Elfn2 G C 15: 78,673,595 P251A probably benign Het
Epg5 T C 18: 78,023,271 probably benign Het
Evc2 A G 5: 37,417,467 D1022G probably damaging Het
Fat3 A G 9: 15,945,008 probably benign Het
Fbn1 A T 2: 125,309,755 probably null Het
Gm15217 T C 14: 46,383,219 probably null Het
Gm17611 A T 13: 49,976,399 noncoding transcript Het
Gpld1 G A 13: 24,962,320 W182* probably null Het
Gsc T C 12: 104,473,094 I8V probably damaging Het
Hck A G 2: 153,134,132 K197R probably benign Het
Kat6b T C 14: 21,670,233 L1551P probably damaging Het
Lrch1 C T 14: 74,947,545 G39D possibly damaging Het
Macf1 T C 4: 123,365,355 probably null Het
Mroh9 A T 1: 163,060,762 V248E probably damaging Het
Mrps15 C A 4: 126,051,417 probably benign Het
Mum1 A T 10: 80,229,025 N30Y probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ndufa5 T C 6: 24,522,751 T31A probably benign Het
Nfyb A G 10: 82,750,760 V190A possibly damaging Het
Nos2 A G 11: 78,928,583 I40M probably benign Het
Olfr1019 A T 2: 85,841,515 I92N probably damaging Het
Olfr1084 A T 2: 86,639,330 I126K probably damaging Het
Olfr452 T C 6: 42,790,174 I45T probably damaging Het
Otog T C 7: 46,305,877 S564P probably damaging Het
Pak7 C T 2: 136,116,629 A180T probably benign Het
Pappa2 T C 1: 158,763,058 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plxnc1 T A 10: 94,796,482 N1431I probably damaging Het
Prph A T 15: 99,057,438 I429L probably damaging Het
Prrc2a A G 17: 35,149,688 probably benign Het
Rad54b A T 4: 11,563,394 T18S probably benign Het
Ranbp2 A G 10: 58,485,768 E2629G probably benign Het
Rec114 G A 9: 58,657,770 T201I probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec23b A G 2: 144,581,997 E522G probably damaging Het
Sgsm3 G A 15: 81,009,770 R502H possibly damaging Het
Sh3pxd2b C A 11: 32,423,023 A730D possibly damaging Het
Spag4 A G 2: 156,067,979 D187G probably damaging Het
Srgap2 G A 1: 131,336,437 T465I probably damaging Het
Tecpr1 C A 5: 144,195,941 R1159L probably benign Het
Tmem63b A T 17: 45,666,315 probably null Het
Tmtc1 T A 6: 148,415,758 D78V probably damaging Het
Tpp2 A G 1: 43,990,562 N68D possibly damaging Het
Ttn C A 2: 76,939,925 A2641S probably benign Het
Uimc1 T C 13: 55,093,219 K19E probably damaging Het
Utrn T A 10: 12,688,294 E1274V probably null Het
Vmn2r102 A T 17: 19,694,368 I732F probably damaging Het
Wrn A T 8: 33,268,750 M792K probably benign Het
Zfp451 A G 1: 33,777,045 I608T probably damaging Het
Other mutations in St3gal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:St3gal6 APN 16 58484775 missense probably benign 0.31
IGL01583:St3gal6 APN 16 58493670 unclassified probably benign
IGL02512:St3gal6 APN 16 58473459 missense probably benign 0.00
R0212:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0212:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0441:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0442:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0442:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R1786:St3gal6 UTSW 16 58475871 missense probably damaging 1.00
R1939:St3gal6 UTSW 16 58473561 splice site probably null
R2233:St3gal6 UTSW 16 58473534 missense probably damaging 1.00
R2274:St3gal6 UTSW 16 58488969 missense possibly damaging 0.46
R2336:St3gal6 UTSW 16 58493704 missense probably damaging 1.00
R2434:St3gal6 UTSW 16 58470652 missense probably damaging 1.00
R3789:St3gal6 UTSW 16 58484773 missense probably benign 0.07
R6318:St3gal6 UTSW 16 58486406 missense probably benign 0.01
R7320:St3gal6 UTSW 16 58493711 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCAACCTGTAAGACATGAGAGC -3'
(R):5'- TTCAGACTCCAGTCACTATGACCCC -3'

Sequencing Primer
(F):5'- GAGCATATCCATTTGGTGTCCAAC -3'
(R):5'- AATACTACAGCGGTTCTCGTCG -3'
Posted On2013-05-23